Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4289
Length(NT) : 1046
Best Gene Model Blast : Link to GSTUMT00011023001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_12801
Accession: ref|XP_001586224.1| Score: 1114 E_value: 1e-120
KEGG Definition: hypothetical protein
Accession: ani:AN5990.2 Score: 1059 E_value: 1e-113
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1176 Score: 835 E_value: 4e-90
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 556 E_value: 1e-57
Swissprot: Q9LU36|4CL4_ARATH
Gene Ontology:
GO:0016207 = Molecular function: 4-coumarate-CoA ligase activity

Sequence:
>Contig4289
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGACTGGTTGCGTTTCTGCC
ATTCTTCCATATATACGGATTGACTTGCATGGTGCATCACGCAATTCTAC
GGGGATTACCAACAGTGGTAATGGATCGCTTTGACCTGAATAAATTCTGT
CAACATATCCAGGACTATAAGGTCACCTTTACATACCTTGTGCCACCCGT
GATACTTCTTTTGGCAAAGCACCCTGACGTAGCCAAATACGATTTCAGCA
GTCTCAAGATGGTGAACTCTGGCGCTGCGCCACTCACTAGGGAGTTGGTG
GAGTCTGTGTGGGCTAGACTGAGGGTTCCTATTAAACAAGGCTATGGGCT
TTCCGAGACTTCTCCAGTGACGCACTCTATGCGATGGAGTCAATGGAAAT
CACATATTGGGAGTGTTGGGCAATTACTTGCTAATATGACGGCAAAGTAT
GTCAACGAAGAAGGGGTGGAAGTTCCTGCCGGTGAAACCGGAGAACTTTG
GATGGCTGGACCTAACATCATGATGGGCTACCTTAACAACCCAACGGCAA
CTGCCAACGCGATTACCCCAGATGGGTTCTTTAAGACTGGTGATATCGGA
TACCAAGATGGCGATGGAAACTTTTACATCACCGATCGTGTCAAGGAATT
GATCAAATATAAGGGTTTCCAAGTCCCACCTGCTGAGCTTGAGGGTTTGT
TGTTAGGGCACAAAAAGGTTGATGACTGTGCCGTCACTGGCATTTACAGT
CCTGAGGTGGCAAGTGAAGTACCTAGGGCATACATCGTCCTTGCTGCCGG
GGTAGAGCGGACTAGAGACACGGAGCTGGAACTGATCAAATATGTCGAAG
ATAAGGTTGCTCACCACAAGAGATTGAGAGGGGGAGTCAGATTTTTGGAT
GCAATCCCGAAGTCTATCTCTGGAAAAATCTTGAGAAGGGTTCTGAGGGA
TATGGCCAAGGAAGAGGACCAGGGAGAGGCGGCTCCTCGGGCCAAGCTCT
AAAGGGGCCCTATTTCAGGATCGAGGATGCTTTCACAGGTTATGTG

Sequences in the Contig:

SY0AAC29YI04FM1 SY0AAC53YE13FM1 SY0AAD43YI24FM1
SY0AAD52YB12FM1