Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4288
Length(NT) : 708
Best Gene Model Blast : Link to GSTUMT00003263001 E-value : 1e-149
Numbers of ESTs : 3

Blast Results:

Nr Definition: vacuolar protein sorting 26
Accession: ref|XP_965128.2| Score: 434 E_value: 6e-72
KEGG Definition: hypothetical protein
Accession: ncr:NCU02743.1 Score: 434 E_value: 3e-72
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3063 Score: 361 E_value: 3e-35
PFAM Definition: Vps26, Vacuolar protein sorting-associated protein 26. Vacuolar protein sorting-associated protein (Vps) 26 is one of around 50 proteins involved in protein trafficking. In particular, Vps26 assembles into a retromer complex with at least four other proteins Vps5, Vps17, Vps29 and Vps35. This family also contains Down syndrome critical region 3/A..
Pfam Number: pfam03643 Score: 354 E_value: 2e-34
Swissprot: Q10243|VPS26_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005768 = Cellular component: endosome
GO:0005634 = Cellular component: nucleus
GO:0030904 = Cellular component: retromer complex
GO:0006886 = Biological process: intracellular protein transport
GO:0042147 = Biological process: retrograde transport, endosome to Golgi
GO:0030437 = Biological process: ascospore formation

Sequence:
>Contig4288
TTGGCCGATACATACCAGCTTTTGTTTCAACGAACCCCACTCTCTCCTCC
GGAATCCATCTTGCTTTGTACTAGCGGTCCTGAATTGCCCTTGCTATGTC
GTACTTCTTCTCTACCCCGCTGGATATCGACATCCGACTGGAGGACTTTG
ATGAAAAACGGCAGATGGTGGATGTGAAGCTCGACAAGAACAGACGGGAA
AAATGTCCACTCTATTCGGATGGAGAATCTGTAAAGGGGGCTGTCACCAT
TCGGCCAAAGGATGGGAAGCGTCTGGAGCATACGGGGATCAAGGTGCAAT
TCATTGGGACAATAGGTTGGCTGTCCTTCAATCGAATATACGAAGCTTGT
GTGTTTGCCTGGCAGCGCAGCAGGATCGGGCTGTCGAACAACGTGTGTGA
TTGAAGCTATGCTGAACATTGTGTGTTTGCTTTTCTTGCACTTTAGAGAT
GTTCTACGATCGTGGAAACCATTACGAATTTCTCTCCCTTGGTCAAGAGC
TGGCTGCCCCTGGCGATCTCCAGCATCCGCAAACCTTCGAATTTGAGTTC
AAGAATGTCGAAAAGCAGTATGAGTCGTATAACGGCATCAATGTCAAGCT
TCGCTACTTCGTTAGGGTTACGGTTTCGCGGAGGATGGCAGATGTGATCC
GTGAGAAGGACATATGGGTATATTCTTACCGCATGCCACCCGAGAGCAAC
AGCTCGAT

Sequences in the Contig:

SY0AAC29YI03FM1 SY0AAC4YF11FM1 SY0AAD7YJ01FM1