Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4287
Length(NT) : 1051
Best Gene Model Blast : Link to GSTUMT00004241001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_14129
Accession: ref|XP_001584846.1| Score: 292 E_value: 2e-24
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g712 Score: 277 E_value: 5e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4287
TTGGCATAACTAGGACAGGTACTCCACGATGATAGAGCAGAGTATTACGC
GGACTTTTATGTGAGATGATTTTTCTATATATTTGAAGATATCTACCATA
ATATCATGAGCCCGAAAGTTTTAAGAGAAAGATAGGTGCCCATCACCGCC
TCTTAACAACCCCAGACACACACAAGCGCCGGGCGATCTCGAGCTTGTAT
CATATTTCTACGTTTCACCCCACCCCGCGCTTAGTAGATTACCGTAATTT
AATAGCATAACATAACATAACTTGGGCTACCTACAGCAGCCCTACCGTAC
CGGTGCTGTACGTACAAGTACAGTACCCTTTGATTCGGACAGTACCGTAT
CCACCCAGTCAACCAGCCACCGACGTCTGATTTTTCTTTATTTACTCCTT
TGTTTGTGGAGAGAATCATCCACCGTTTGCCATCTTTGCTCCCCTACACA
CACAGCGACGACGACGACGACGACAACGACTACAAGTGTGATAGAGAGAG
AGAGAGAGAGAGAGAGGTGGACTGGATTGGAGATGAAGAGGATATTGACA
ACGTTCAAGAGGGAGAAAGGGGATGCAAGCGAAAGATACAGGGACGCAGG
AGATCGCGGAAGAAGCGGTTCTTCAGCTTCACTAGCGGAGGATGATTCCC
CGGAGGGGAGGATCGTGATCGCTACTAAATCGTTCTGCGAATCTGGCGGT
CCGCAAAACCAAAACCCGGGCGAGGAGGTGCTCTACCTCCCCACCATCGT
CGACTTGGCCGAATCCTCGCCGACGGCAGCGCGCGCGGCGGCGCACACGA
TACGCAAGTACCTAGAGACAAAGAAGAATAACAGTTTGCGGCCGCACACA
CAGTGCAACGCCATCATGCTGACACGCATTCTCAGCGACAACCCAAGCTG
CGCCTTCACGCGCAATCTAGCCGAGGCCAAGTTCGTTGCGGCGGTGAAGG
AGCTACTAAAGCATGGGCGAGAGCCGAGCGTGCGACTGAAACTGGTCGAG
ACGCTGGAGCACTTTGACGGGAGGGTGACGGCGAGGGCCGGAGTCGGAGT
C

Sequences in the Contig:

SY0AAA38YP18FM1 SY0AAA58YO11FM1 SY0AAB29YK04FM1
SY0AAB51YB06FM1 SY0AAB61YD13FM1 SY0AAC29YI02FM1
SY0AAD55YG07FM1