Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4286
Length(NT) : 1371
Best Gene Model Blast : Link to GSTUMT00008236001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001244072.1| Score: 1448 E_value: 1e-158
KEGG Definition: Sof1-like rRNA processing protein (contains WD40 repeats)
Accession: aor:AO090001000418 Score: 1410 E_value: 1e-154
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0268 Score: 1438 E_value: 1e-160
PFAM Definition: Sof1, Sof1-like domain. Sof1 is essential for cell growth and is a component of the nucleolar rRNA processing machinery..
Pfam Number: pfam04158 Score: 251 E_value: 4e-22
Swissprot: P33750|SOF1_YEAST
Gene Ontology:
GO:0005732 = Cellular component: small nucleolar ribonucleoprotein complex
GO:0032040 = Cellular component: small subunit processome
GO:0000462 = Biological process: maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)

Sequence:
>Contig4286
TTGGCATTGACATCATACACACTTCGAGAATTCCTACGCCTTGTCACTGG
AAATTTATCCCCATCAAACCATATTGACATAAGCGCGGTCCCAACTCGAA
CTGTCCCTAGCATGAAAGTGAAAGCTCTTTCCCGATCGTCCTTGACATAT
AGTCCTGCGGGAACAAATGCCACCGTGCAACCCCGAAACCTGGATCCTGA
AATACACCCTTTCGAAAGGGCCCGTGAATATACCCGAGCATTGAATGCGA
CCAAACTAGAGCGCATGTTTGCGGCGCCCTTCATCGCTCAACTGGGAATC
GGCCACATCGACGGCGTATATTCGCTAGCAAAAGACATACGTGCTCTCGA
CCGAATAGCATCAGGTTCTGGCGACGGTGAGGTCAAGATATGGGACTTGG
CGGATAGAAAGGAAATTTTGACAGTTAAGGCTCATGAGGGGATTGTGAAG
GGATTGTGCTTTACATCCGTCGGTGGGGACGATCGATTGTTATCCTGCGC
GAGTGATAGGACGGTCAAGTTGTGGGATCCACAAGGGGCCGGCGTTAGCT
CGAACGTTCCCACTGCGACATATCTTGGGCCTGGCGCCTTCAATGGGGTC
TCACATCACCGAGTGGATCACACATTTGCCACTGCATCATCTATGATAGA
TATTTGGGATACCAGCCGTTCGAAACCGATCACAACTCTCCAGTGGGGCG
CCGATACAATCAATACGGTCAAGTTCAACCAGTCAGAGACCTCCATCCTT
GCTTCGGCGGGATCGGATCGAACCTTGATATTCTACGATCTTCGGACCTC
GTCTCCGACGGCTAAAGTTGTCACAAGGCTACGGACGAATGCCATCTGTT
GGAATCCGATGGAACCGTTTAACCTTGCTGCTGCGAGTGAGGACCATAAT
ACATATATCTTTGACATGCGTAAGCTCAACAGAGCGTTGAATGTCCTGAA
GGATCATGTTGCCGCAGTCATGGATGTGGATTATTCACCTACCGGGGAAG
AATTAGTGACTGGTAGTTATGATCGGACTGTCAGAATCTATAGGGCCCGT
GAGGGGCATTCAAGGGACATTTATCATACAAAACGAATGCAACGCATCTT
CTCGGTCGCCTTTACAACTGACACTCGTTATATTCTTTCTGGGTCCGATG
ATGGGAATGTCCGCCTCTGGCGGGCTGAGGCCTCCCAGCGCTCCCACGTA
CGCTCGGCCCGCGAGCGTACCAAACTCGAATATGATAACGCGCTTAAAGA
AAGGTATAAGCATATGCCTGAGATTCGTAGGATAGCGAAGCACAGACACG
TCCCTAAACCCATAAAGAAAGCGGGAGAAATCAAGAGGGTCGAGGAAGCT
AGCCTCAAGAGAAAGGAGGAG

Sequences in the Contig:

SY0AAA35YB14FM1 SY0AAA54YF11FM1 SY0AAB16YK06FM1
SY0AAB56YD16FM1 SY0AAB60YM17FM1 SY0AAC29YH12FM1
SY0AAC38YO07FM1