Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4285
Length(NT) : 1122
Best Gene Model Blast : Link to GSTUMT00005669001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4285
TTGGGTAAAAGGCCTTTCCTCACCATGCCATTCTAACCGCAATAGAAAAT
ACCCTGCCAGTGCGATATCGGCAGACTGCCGGTGTCAAAACCATATCTCG
CCAACTCAGGGTCCAAGCTGAGGCATCTTTCTCTTGTCACCCCCACAATC
ACTCCTACAACACAATCTTCTTCTAGCGTCCGATTGAGAGCTCTGTTCGA
TATGACTTTTCTATACCTATGATATCACTCTACTGGTTATAGTGTCGGGA
GGTTTATTTGTTGTTCTCGAAGCATGTCAGTTGGCTCGACCCTTCTACGA
CGAGGAGTTTGCCTTCATTTTTTGCGGTCGTGCGGTAAATCACGGGGCAC
ATATTTCTCCACACAGAGCCGCCCTCAAGAACCAGTGCCACGACAGCTGC
GACCACTTATACCACACCAAGCCTTGCGTCCAACACCACAACCACGACCA
CTAACAGCTCATTGGGGTTTTAGTCATTCGACTGGCGCCTTAAAGCCTGA
TAAACACAAGCGTCCATCAAGCCTAAAGCTTCACAAGCCAAAGCCTAGAC
CCATCCTTCCCAAGGCCGCTAAAACTAAAATCAAGATGAATAGCTTTGTG
GAATACAAAACCTTGAAAAGCTTTCCTTACAAATTTCTCACCAAAGCTGA
TCAACATGTTGTCAGCCGTTTCTTTGATTCTAATCCCTTTCATGCCTATG
GCTGGAGAATATACATCTACGAAACTGCTGTCAGCGAAACTATTTTGATC
CCTTGGGATCAGATAGATCGGTTCTTTAAAGAGATTGCAGCTGAAACCGG
CATACACCTCTTCCAGAATTTCCCCGCCAAGAAGATTTCTTACAAATTAG
ACTCCAACGAAGATGCTCCTGCCCTTATGGGTGATTTCAAGAGTAAGGAA
GAATTGGACGAACTTTTGCAACAATTCGGTACCTCGTCGGGAAAGGGACC
TATCAAGAAGAATAGCACGCCCAAGTCCAGACGAAATGCCGCGAGGAGGC
TTCAGGCAATGGAGACTTGGAAGTCTCAGGTCAGTTCCGCAAGGAATCAT
CTCAAATACGATCAACAGGATCTTGAAAACGGGGTCAAAATAGCCTTTCC
CGTATTTGTGAGCATTGACGTT

Sequences in the Contig:

SY0AAB49YL14FM1 SY0AAC22YB07FM1 SY0AAC29YH10FM1
SY0AAC50YN02FM1 SY0AAC54YP06FM1 SY0AAC8YH15FM1
SY0AAD49YH03FM1 SY0AAD50YA03FM1