Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4284
Length(NT) : 893
Best Gene Model Blast : Link to GSTUMT00005349001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: PREDICTED: similar to geranylgeranyl transferase II
Accession: ref|XP_422548.2| Score: 463 E_value: 2e-44
KEGG Definition: RABGGTB, LOC424723; Rab geranylgeranyltransferase, beta subunit
Accession: gga:424723 Score: 463 E_value: 1e-44
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0366 Score: 559 E_value: 4e-58
PFAM Definition: DDOST_48kD, Dolichyl-diphosphooligosaccharide-protein glycosyltransferase 48kD subunit. Members of this family are involved in asparagine-linked protein glycosylation. In particular, dolichyl-diphosphooligosaccharide-protein glycosyltransferase (DDOST), also known as oligosaccharyltransferase EC:2.4.1.119, transfers the high-mannose sugar GlcNAc(2)-Man(9)-Glc(3) from a dolichol-linked donor to an asparagine acceptor in a consensus Asn-X-Ser/Thr motif. In most eukaryotes, the DDOST complex is composed of three subunits, which in humans are described as a 48kD subunit, ribophorin I, and ribophorin II. However, the yeast DDOST appears to consist of six subunits (alpha, beta, gamma, delta, epsilon, zeta). The yeast beta subunit is a 45kD polypeptide, previously discovered as the Wbp1 protein, with known sequence similarity to the human 48kD subunit and the other orthologues. This family includes the 48kD-like subunits from several eukaryotes; it also includes the yeast DDOST beta subunit Wbp1..
Pfam Number: pfam03345 Score: 177 E_value: 8e-14
Swissprot: P20133|BET2_YEAST
Gene Ontology:
GO:0005968 = Cellular component: Rab-protein geranylgeranyltransferase complex
GO:0005515 = Molecular function: protein binding
GO:0004663 = Molecular function: Rab-protein geranylgeranyltransferase activity
GO:0018348 = Biological process: protein amino acid geranylgeranylation

Sequence:
>Contig4284
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGAAGATTGCGGGGGTTTTT
GAGAAGTCGTTGTCGGAGGATCAGGTTAACCTACTGGGGGACTGGCTGTG
CGAGAGGCAGCTACCGAATGGAGGGCTTAATGGACGGCCGGAGAAACTGG
AGGATGTGTGTTATTCCTGGTGGGTGTTGAGCAGTATGGCTATGATTGGG
AAATTACAGTGGATTGATAGGGAGAAGCTAGTCGAGTTCATACTTTCTTG
TCAAGATGAGGAGAACGGGGGGATTGCCGACAGGAAGGGAGATGTAGCGG
ATGTTTTTCACACAGTCTTTGGGGTTGCTGGCTTGAGTTTGTTGGGCTAC
GAGGGACTCAAGGAGGTTGATCCTGTTTATTGTATGCCAAAGGATGTTAC
TGACAGGATTGTATGGAATCATCGAAAGATTCTTACAACTTAAAGCCCTC
AAAAATTACTTCATAAGCAATAATATCCACTCCTCGAGTAAGTCAGTCCA
AACATCACAATCCATCTCGCAACACCATTCAAAAAGCAATTGAAGCTGCT
ATCCTAGCTTAGCACCATCGTCCGGATATCTAGCCACTCTTTAATAATAC
ATAACCCTATCAAAAAGAAAAAATCTCCATAAAAAATGCAAAATTTTACT
CCGTCTTTTTCAACCCCACCCTAGCAGCAGTCGGTGCGCTCCAGAGCCAT
AAGGCGCAGAACACAATCCACCCAGTGATAGTTACCACAATACCGGCAAT
CCAGACCCAGGCACCACTAATATTCCAACTCCTAGTATACTCGTCATGCG
CAAAGTGTCTAACAGTCACACTATACTTCTCATCAATATAGGTGATGTAT
GGGCGCTTGTAGTTTACTCTGAAGGCAAAAACACCATGCCCAA

Sequences in the Contig:

SY0AAB35YJ14FM1 SY0AAC29YH03FM1