Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4283
Length(NT) : 2234
Best Gene Model Blast : Link to GSTUMT00001660001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein CIMG_07801
Accession: ref|XP_001240638.1| Score: 286 E_value: 2e-23
KEGG Definition: hypothetical protein
Accession: ani:AN6819.2 Score: 228 E_value: 6e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4283
TTGGCACCGAGACAGCCAACCCCCTCTTCCACCCTGCTCGAGCCACCCTG
CTTGAACCACCCAGAAGCTGTCTGAGATGCAAAACGGGACTCCCGCTCCT
CCGTCGTACCCCCCCCTTCCCACCGGCTAACGGTGCCTATGTGCAGTTCC
TCCTTGCGCCTTCTTTCATCCCTTCCTCCACCCACCTCTTTGCTACCCTA
CTGTTATAGTACCCCAAGGCCGATCATTGACTCACTAGGGAGCAGAAAAA
CTGGCCTGTAAGCAGGTGGCACTTGAAGAAGCTCTTCTATGAGTAGAGTG
TGCAGTGCATGCTTAGTTTTGCGAAGATCTCCCATATTTCCGATGCAACT
TCTGCATTAACTTATTAATACTACATGCTCCAGTTCCGTAAACCCCCAGC
TGATTGGCTCAGCCCATTGCTCCAGCATGGGCGAGTACGAGTAGTAACAT
TGCGGGCCAGTCGGAACCATGCAGGACACAGCCCACAGAAAGGTATTTAA
GCCTTTCGTTCCCTTCTAGCGCTCTTCTTGGGACCTGGCGGACTCTTACG
CTCCTGCTCGATATCGGTACTCTGATCGGCCTCCCCGTCCCCCTCTCCCT
CCATCTCTTCCGGTCCTCATACCCCCAAGAATTATATCGTTCAAGTTACC
AACTGTCCTAGTCTCACGGAAGGTCTCGGTTTTTTGCAAGCCCTCCTAAA
GGGTTAGGGGGAGAAGGAGAGAAAGGACTGCTATAGCGAAAAAGGCATCC
TGAGGACTCCTTCCTTTTCCTTTATATCAAGCTCTTGCCAAACCATTCCC
CGCAAAAGTGGATCCAAGAGAATCTTAAAACCTTGGTTCTCGAATCTCTG
TTTTTATATCTTTCACCACGCCCTATACGGTCATTTCGCCCATACGCCAT
CATACACGCAATCATTGATCTCCGCCCCGCGTTTTATTCCATTCAGTTCC
CGCATCCCAATCAAAATGTTTCTCACATTACCCACAGCAGCGACTGGCGC
AGCAATCCTCCTGTTACTACTCCCCCTGATGACGGCGGCGGAATGTGAGT
GCGGGTACATGCTCAGACAAACCAGCACGTTCTTCACTCACAAGATGCAC
ACTGATTTCTCTAAAATCCCGGATACTACGGACGTCAACACCGCACTATC
AGACTGGGAGGTCCAGGACTGGGCGTTCAACACGAGCTCGAGTGCTGGAG
TGATGGCCAGGAAGAATGACGCGGAGAACGTGTGGATTAAGGACGGGAGG
CTACACCTACGACAGAAAGGGCACAAGGATGGTGATGACGGGCCCATTAG
CGTTGCGGAGGTAGACAGCAAACGGACGGACTTCCAGCATGGGGAGTTTC
AGGGCGAAGTTCAAGGTCACTGTGGATAAGAAGGCGGTTGGGGGAGCTGT
TGCTGGGTTCTTTTTCTACTATGACGATGAGGATGAGTCAGATATAGAGA
TCCTAACCAGAGACGGCGACAAAACCATCCGCTACACTCAACACCCTGCG
TACGATAGTGCCACCGACACCACCATCCCGGACGCAACCTTCCAAATCCA
GCTCAAGAAGTCATGGTCAAAAATGCAAGAACACCGCTTTGACTGGACAC
CATCAAAAACAACCTTCTTCCAGGATAACTCCGCAATCAAGGAAATGACC
AAGAACGTTCCCAAACATGAAGGCAAAATCATGATCAACCTCTGGGCCAA
CAACGGCACTTGGAGCGGCCTCCCATCAACCAAAGACGTAAAAATGGAAA
TGGAGTACATAATGATGTACTTCAACACCAGCGCATCCCAATCCGGCAAC
GACAAGGACTTCAATTCAGCTTGTGAAGCGGCCGGTGGGCCAGAGAACGA
GACCGTCTGCTGGATCAACGACAAATCCGGCGTCTACAGCGAAGACTCAA
AAGTCACGCTTTCTGCTTCTCCTGCTGCCTCCATCTCGCAGAACCTGGTC
CTCGTTGTGGGGGTGGGCCTGGCGGCGTTGTTGCTAGTTTGGACATAATA
TGCCTCTTTTTCAGACTCCCTCCCCTTTTTTTTTTTACCCCATTTTTGCT
TTAGATGGCCCTGATTTACGAGGAGGGAAAAAAGAGGGAACGCGGGGAGG
GTTTTTGTTTTTCCCCTTTATTTCAATTTTATTTCAATTCTATGTATTTT
AATTTGACAGCGCTATTACGAGATACTTGAGGAAATATGTTTTCGCTCAC
TGCTCTGCATAATTTAGCCCAACCCTAATGTACA

Sequences in the Contig:

SY0AAA12YK09FM1 SY0AAA36YG21FM1 SY0AAB38YC06FM1
SY0AAB7YF23FM1 SY0AAC16YD05FM1 SY0AAC29YG24FM1
SY0AAC40YD20FM1 SY0AAC55YE04FM3 SY0AAD41YG07FM1
SY0AAD6YD01FM1