Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4282
Length(NT) : 1011
Best Gene Model Blast : Link to GSTUMT00003265001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_06688
Accession: ref|XP_001592447.1| Score: 232 E_value: 2e-17
KEGG Definition: hypothetical protein
Accession: ncr:NCU02704.1 Score: 211 E_value: 2e-15
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0558 Score: 202 E_value: 1e-16
PFAM Definition: No Hit Found
Swissprot: P11182|ODB2_HUMAN
Gene Ontology:
GO:0005947 = Cellular component: mitochondrial alpha-ketoglutarate dehydrogenase complex

Sequence:
>Contig4282
TTGGCTCTTTCTTTCTTTTCTTTTCTTTTTTCTTCTTTTTACCTTTGGAA
ATAGGGATAAAAGAAGAAATAGAAAGGAACTCCTTCCGGAATCACACGTT
TGGCCCCCCTTTACTTGCCTGCAGGCTATACTTGAGGCGGGAATTAAGGT
TTTATTTTTGTTTTTTATTTTTAAAAGGAAAAAAAAATAAAAAAAGAGAG
AGAGAGAGAGAGAAATTGCTGTCGTGTGTGGTTTGCTTACTCGGATAAAA
GGAGGAGCAGAAGATGCTGTGGGGCAGTACCGGCAGTCGAACGGTTGTGC
GAGCTAGATTTTTCCGGAGGAGTAACAGCAGCAGCAGCAGCGTCAGAGTC
CTCCCTCCATTTATTACTACCACTGCAAGATCGTCGTTGTTGTCTGTATC
GAAGTTGTCGAGGTCAAGGGGGCTCAAGAGTTCTGCTCGGGTGCTTGTCG
TGAAACCATTCTTACTCGCGGATATTGGTGAAGGAATCCGTGAATGCGAA
GTCATACAATGGTTCGTTCAGCCAGAGGCTAGAGTGGAGCAGTTTGATAA
GCTTTGTGAGGTTCAGTCTGATAAAGCTTCTGTTGAGGTAAATTCCTCTC
CTTTCTTATTTATTTTCGGAGGGTTTTTTTTATTTCCCCTCTTGCGGGTT
CTTGACTTGCTTGCCGTTCTCGGATAAATGTGGGGGTTTGCTGCTCGTAC
CGGTCGGGCTTCTGGCCGGCTGGTTGGACTCGATCACTTCACGCTACGAT
GGGGTCATCAAAAAGTTGCACTACGAGGCCGGGGACATGGCAATTGTTGG
AAAGCCTCTCGTCGACATTGACCTTCAAGCCGACATCAACGATCCCGAAC
TTGGGGAGATGCAGAGCAAGACCCCTGCAGTGTCTGCGGTTTCAAAGCAA
GCACCTAAGATATCTGAGGGCATGAATGGACCCGGACAGTTCTCAACGAC
GAGGCCCCACGGATCCCTCGCCACACCAGCTGTTAGACGTATGACAAGAG
AGCATGACGTG

Sequences in the Contig:

SY0AAC29YG09FM1 SY0AAC46YN16FM1 SY0AAC53YK18FM1
SY0AAD61YO24FM1