Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4281
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00004411001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001549926.1| Score: 666 E_value: 3e-68
KEGG Definition: hypothetical protein
Accession: ncr:NCU05600.1 Score: 652 E_value: 6e-67
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1236 Score: 431 E_value: 1e-43
PFAM Definition: No Hit Found
Swissprot: Q02981|YP109_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig4281
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGCCGCCTCCAGCATATG
TTGATCATGGACAACTTTATCCACGCAGATCTGCATCCTGGAAACATAAT
GGTCCGATTCTACAAGCTCGAGCCACTCCCTTCCTTGTCACAGTTCCCAT
TAGTCGTTCCGGGCCGCAAGGCTAGTGCCAGAGGTGCCGATAATCACAAG
GAAGTGACAGAAGAAGTCATTTCAAGACTCATACCTCATCGTGGGAACCC
GCAGGAATGGCAAAAAGAATTAAATCTACTGGACAATGAAGGCTACAGGC
CACAGCTTATCTTCATCGACACAGGGCTTGTGACAGAGTTGAACTCCGTG
AACCGTCGTAATTTTCTGGACCTTTTCCGCGCCATCGCTGAATTCGACGG
ATATCGCGTAGGGCATCTTATGATTGAACGTTGCCGTTCACCCTCAGCAG
TCATCGACAATGAAATATTCACCCTCAAGATGCAACACCTTATCCTTGCG
GTGAAGAGCCGAACACTCGCGTTAGGAAACATCAAAATTGGTGACCTCTT
AACCCAGGTTTTGCAGATGGTTAGAGTTCATCACGTCCGAATGGAAGGAG
ATTTTATCAATGTTGTACTATCGATC

Sequences in the Contig:

SY0AAB32YB01FM1 SY0AAC29YG07FM1