Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4280
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00010090001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4280
TTGGATTCCGACAAAGCTTCTTCACCCCCCCTCCCATCTGAGAAGCAGCG
ACATCACAGAGCCGACAGCGGGCAGGACGGATATTGCACAACGACAAGCC
GAACATCATGCTTAGGCTCATTATCAACAAACAAACGTTCAAGGCTATCA
GCATTCACCCCTACCGTCCACATAGGGGCTTTAGCACCGTTCCGGGACGA
AACACCGATAGTGACAGTCATCATGATAACGATTACCACCATGATTCCAG
CGGTGGGTGTGCCGGCTCGGGGTCCCCGCCAGGCGTTACCTCGAAAGACT
TTGCCAACCTTGATAAGGATGTTTCCAACATCAAACTGAAGCTCGACTAC
ATCCAATCCGGACAGAGCGAGATGAGAGCTGATATTAAAGACCTTGGCAA
CAAGACGGATAAAAAATTTGACAAGACCGATAGTAAGATTGACCGTATAT
TCTACGGTGTTATTACTACTCTTGTTGGGTTTGTCTTGAAAGGTGGGTTC
GATTATTACCAGGCCGCCAAGAAGTAGGCTTGGACATAGATGCGACTCTC
TCCATTGCCTCGGGGTTGATTAATTGGCAATGACGCTGATAGACTTTTTT
TTCTTTTTTTCCCCATCAATTGGCGC

Sequences in the Contig:

SY0AAA44YG10FM1 SY0AAA54YN03FM1 SY0AAB38YB02FM1
SY0AAC29YF24FM1 SY0AAD40YI01FM1 SY0AAD42YE15FM1