Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig428
Length(NT) : 1212
Best Gene Model Blast : Link to GSTUMT00003874001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59478.1| Score: 321 E_value: 9e-28
KEGG Definition: predicted protein
Accession: aor:AO090023000993 Score: 321 E_value: 5e-28
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O13695|YEN1_SCHPO
Gene Ontology:
GO:0009986 = Cellular component: cell surface

Sequence:
>Contig428
TTGGGTTAATCGCGATTGGATTGTTGTTTCTTTGGAAGCAACGACAAAAG
CGCAAGGCTGATGCGGAAGCCCGAAGGAAAGAGGTGGAGGAATATGGCTA
CAACCCAAACCAAAATCCCCACGGAGGTGCCATCGCCGGAGCCGCCGCGG
CTCGGGGTATTGATGGCGAACCTGGTCAGTATGAGATGGCAGAAAGCGAA
GCCACCGGTTATAGAGGATGGGGATCAACGAACGGTGGTAGAAAGTTATC
TGGGATGGGTTCTAGCGTTGCAACCAGTCAGCAACCACTGTCGCCCGTTG
GAATGGGTTTTTCTGAGGGAGGATATAATAGACCACTAGAAGGTCCTGAT
GGGTATGCTGGTGTCGCTACATCTCCGAGCGCATCGAATTTTCCTGCAGA
TTCTAGTGTTATTGGCGCCATGAATGGGCCACAGACGGCGGATAACTCGG
AGGGGATCCATCGAGGAATATCTAATGCATCCTCCAACTATTCTGCCGTT
ACACACTCGACAAAATCCGATCGGGGCCAGCCCCTCTCACACCACGATGC
CCAGTACTATGGTGCGGATGCCGTATACGATGACGGATACTACTACTCTA
ATCACCCGCCCCACCAATACTCCGATGATGCGGGGTCTGCACAAGTGCCA
GTGATAAGGGATGTCCAAGCAAGAAGGAACACACGCATCGAAACTCCGAC
AAACACTCACTTCCCCCAGCAAGGAAATACTGGTAGCGGAATCGCGCAGA
ACTTTTGAAGATAGGGAGGTTTAGGTGCAGTCTGCGTGACGCAAGTTCTT
CCCTGTATCGTCCGGTCTCAGTGTTCCAAAAGTTGGAATGATTTCCATAC
TTTCAGTTTCACCCACCGAGGAGTATCCTATCTCTGTAGTTCCTTTTCTC
GTACCACACTCAATCTTCCGTCTTACTTGGATACCCCACCTTAGCATCCA
TTCTCGGGGTAACTCATTTTCTTGCAACATTTATTTTTCCGCTATAAAGG
CACAAATTTTCGCATCATTTACCCTTTTATGTCACTCGCCGTTCTTTCAA
GCCTTTTCACATTCAAGCGGGTTGTCACTACTGATCTTACGTTACCTCCC
AATATGATTTAACTTTTTCTTGCATGTTTTCGATCAATACCTTTTCCAAA
CCTTTAGTTGGGGAGGATATCTACCGGTAATCTAATGTTGGAACTACATT
CTTTTTCTAGTT

Sequences in the Contig:

SY0AAA23YO07FM1 SY0AAB11YL14FM1 SY0AAB34YI03FM1
SY0AAB36YA20FM1 SY0AAD47YD12FM1