Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4279
Length(NT) : 691
Best Gene Model Blast : Link to GSTUMT00004435001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001387575.2| Score: 500 E_value: 6e-49
KEGG Definition: hypothetical protein
Accession: ncr:NCU00812.1 Score: 518 E_value: 3e-51
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1068 Score: 518 E_value: 2e-53
PFAM Definition: RNase_PH, 3' exoribonuclease family, domain 1. This family includes 3'-5' exoribonucleases. Ribonuclease PH contains a single copy of this domain, and removes nucleotide residues following the -CCA terminus of tRNA. Polyribonucleotide nucleotidyltransferase (PNPase) contains two tandem copies of the domain. PNPase is involved in mRNA degradation in a 3'-5' direction. The exosome is a 3'-5' exoribonuclease complex that is required for 3' processing of the 5.8S rRNA. Three of its five protein components contain a copy of this domain. A hypothetical protein from S. pombe appears to belong to an uncharacterised subfamily. This subfamily is found in both eukaryotes and archaebacteria..
Pfam Number: pfam01138 Score: 252 E_value: 1e-22
Swissprot: P46948|RRP41_YEAST
Gene Ontology:
GO:0000177 = Cellular component: cytoplasmic exosome (RNase complex)
GO:0000176 = Cellular component: nuclear exosome (RNase complex)
GO:0000175 = Molecular function: 3'-5'-exoribonuclease activity
GO:0006402 = Biological process: mRNA catabolic process
GO:0043330 = Biological process: response to exogenous dsRNA
GO:0006364 = Biological process: rRNA processing

Sequence:
>Contig4279
TTGGCTCGTTTCTTAAAAAATTAGAAAATGGTATGATACCAATCTTCTCT
TCCCTCACCATCTCCTCTAATTACACAACCTAACGGAAATAATGATACGA
TGGCCTTCCAGTCCCGCTACGAAATCCTCTCACCAGAAGGCCTCCGCACC
GACGGCCGTCGCTGGAACGAAATACGCCGCTTTTCAGCCAAATTGGCCAC
CACAGCCGCTGACGGAAGCTCATACGTGGAGCACGGCAACACAAAAGTGA
TTTGTTCCGTCAACGGCCCCATCGAGCCTCGCGCCGCTAGCGCTCGCAAT
TCCGAGCGCGCAACGGTCACGGTGGACGTCTGCTTCGCGGCGTTCAGCGG
GACAGATAGGAAGAAGAGAGGGAAAAGCGATAAACGAGTGCTAGAAATGC
AATCCGCCCTCTCCCGCACCTTCGCCACCACCCTCTTGACCACCCTGCAC
CCGCGCTCCGAGGTGCACATCAGTCTGCACATACTCTCCCAGGACGGCTC
AATCCTAGCCACTTGCGTCAATGCCGCCACACTCGCGCTCGTCGACGCTG
GCGTGCCCATGTCGGACTACGTGACCGCTTGCACCGTCGCGTCCTACACC
AACCCGGACGAGTCGGGCGAACCCCTGCTCGATATGAGCTCCGCCGAGGA
GATGGACTTGCCGGGTATCACACTCGCGACTGTGGGCAGGA

Sequences in the Contig:

SY0AAB44YO21FM1 SY0AAB47YH12FM1 SY0AAC29YF08FM1