Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4277
Length(NT) : 852
Best Gene Model Blast : Link to GSTUMT00004328001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein BC1G_14397
Accession: ref|XP_001546600.1| Score: 442 E_value: 5e-42
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01845 Score: 381 E_value: 3e-35
KOG Definition: No Hit Found
PFAM Definition: COPI_assoc, COPI associated protein. Proteins in this family colocalise with COPI vesicle coat proteins..
Pfam Number: pfam08507 Score: 460 E_value: 1e-46
Swissprot: Q03860|TVP15_YEAST
Gene Ontology:
GO:0030173 = Cellular component: integral to Golgi membrane
GO:0005515 = Molecular function: protein binding
GO:0016192 = Biological process: vesicle-mediated transport

Sequence:
>Contig4277
TTGGATCTTTTTCATTGACTGGAGAACCTTATTCCACCCGCCACTTGCTT
GCTCACTTGCTCCTTTCATCAATCGATAACGAGCCCACTCATCACAAAGC
TTTCCTTCCATCTTCCCCTGCACAGCCCCCGAAGTGAGGAGCCGACAAGA
TGGATAGCATGTCAAACATCATTCGCCTTGTGAATCTCGGCGTGGGGGTG
ATTATGGTGCTTGGAGGAATCTCGCAGTTCTTTCCTATGAAGTTGCAGAG
CATTATTGTCGGATGCTACGTTATCGTGTTTGGTCTTGTCACTGCATTAC
TGGAGTTCCAGATTCCTCCACAAACGTCAAGATATGCGTCGTTCCTGTTC
TCGTTCCTTGGTCGCGGTGTTTTCTACATCTTTGTCGGTAGTATTTTGAT
TCACGACAGTATTTTGAGGATCATCGCTGGGTCCATCATTGGGCTCGTCG
GCGCTATCTATGTTGGCCTGGAGTTCGTGCCGTCCATTGAGCCGCCAGAG
AACATGAGGAGCTCCGAATGGGATGGCGAGCAGGTTTAGGGCCATTGCGA
ATGATATCCTGTTATATTGAGACGAGGGACTGCTGTGCGGGATATGGGAT
TATGGTCATCGGGGCAGAGACGGATGCTATGCGGGGATGGGACGAGCGAA
TGGTGGGGATGTAGCGATAGGCACAGAAGGAAACGAACAGTGGTCGGAGG
AATTCTAATGGGTTTACTTGTCTACTTTTTATTATTGCAATGGTTTGGTG
GGCAAGGGCGGAGGCGCCGTTGGCTATTTATTGGATTAGGATGCGTTTAC
GGTTTTATATTGTCTTTTGGGCTTGGAGGGTTGGGGAATCATTTGGGCCC
TT

Sequences in the Contig:

SY0AAA43YE15FM1 SY0AAA48YF18FM1 SY0AAB16YO15FM1
SY0AAB2YA21FM1 SY0AAB31YF19FM1 SY0AAB43YK16FM1
SY0AAB49YG22FM1 SY0AAC29YF03FM1 SY0AAD16YJ12FM1