Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4276
Length(NT) : 1023
Best Gene Model Blast : Link to GSTUMT00011932001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 306 E_value: 5e-32
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 306 E_value: 2e-32
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4276
TTGGCAAAAAAGCCGAACTCAGAAAATAGACTATAGCGCAGATGTCGTCA
GGACACCAACTAGTCACCGGTAACATCAACTCGTTCAACATTGTCAACTT
CAGCACAGAAATAGGCGCCGAGGGACAACAAATTTTGCAGTGGTTATCAC
CACTCGAACCACTACGACGGCACCAAGGTGTGCGAACTGAGCGATTCAAG
GGCGTTGGAAACTGGGTACTAGAAAACAACGAGTTCAAGAAATGGAGCGA
TACGGAAAATGGTTGTGTTGAACAAGTTGTTGTTCTGTTATGGGAATCCA
GGAGTGGGGAAAACTTATCTTAACTCCCTTGTGGTTGATAGCCTGTGTGA
TGAGGCTAGGGGGAAAGACATTGCGGTCGTGGGATTATACAGCGATTTCC
TCGCCCAACAGGAACAGTCCGGTGCAAATATGTTGGGCGCCATCCTCAAG
CAACTTGTCACCAGAGGGGAAATCCCGGAGAATATACGCGAGGAGTTTCT
AAGTGCCAAAAAAGAGTTCGGTGGTCGATGCCTCCTACTTCCTGATCTAA
TAGAAATTCTTAAGACCATTAGACCATTACATCGGGTATTTATATGCATC
GACGCATTAGACGAATCCACCCCCAAGAACCGACGGGAACTCCTGGAGCC
ACTGCAAGAAATCGTCCGGGTGTCACCAAACACGCGAATATTCCTCACCA
GGAGGTCCCATATCGATAACGAAATCATGAAATATTTTAGCAAGGCGGTT
AGAATACCTATTCGCCCTACCCAAAATGATATTAAGAGTTATCTGGAGAT
GAGGCTAGATAGTGACACTGACTCCAATGCAATGGACGACGAATTGCGCG
CCGATATTATGAGAATTATTCCAGAGAAGATCTCGGAAATTTTCCTTCTG
GTTTCTCTAAACATTGATGCAATCCTGGGAGAGATTACCCTCCATCAAAG
AAGGAAAAAGTTGGACGAGATGACAAAAGTGGAGGGTCTGGGTGATGCGT
ACACTGCAACCTTATCACGAGTG

Sequences in the Contig:

SY0AAA35YG02FM1 SY0AAC29YE14FM1