Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4275
Length(NT) : 2607
Best Gene Model Blast : Link to GSTUMT00000473001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65835.1| Score: 182 E_value: 3e-11
KEGG Definition: predicted protein
Accession: aor:AO090103000404 Score: 182 E_value: 2e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4275
TTGGCCACGAATTCTCCAATTAACTACTACGAGTACTTGTACCGACATTA
GGATAACATAATCATCTCAATCCGATTCAATCCTAAATGTACCGCGACCT
CCGACTCCGACTATTCCCAAATCATCCGAACGCGCTGTCCTGGTCGAGGG
ACGGGCAATTATGTGTTATTGCTTCGGAGACTGCACAGATTCTCGTTCCC
AACAACCTAAAACCCCACCACGCCTCCCTCCGCACGCACCTCCTGCACAG
CATACAAACCCTGCCCGAAATAGCCCCTGCAGACGGTGAGTTTCAGGTTT
GTTTGAGGTTTTATCTTTATTTTATTTTATCTTTTCTCATTTTTTCACCC
TTGTTTTAAAAAAGGTGGGGTAATGATTGGTTGATGCGGCTTGCTTGGGA
ATGCAAGTAGCGGAGGTGTATTCTATTGGTGATGAGCAGGGTCCGGGATA
TGCGAGGGCTGCGGCGTGGAGTCCTTTGGGGGTATCGGAGTTTAGGAGGT
GTATTTTGGGTATCCTCACGACAAATCATCAGGTCAAGGTTTTTGTCCCT
GGGTGGGACCCTTGGAGTGATTGGACGATTCGTCACGATCTTACAAAGTA
CCTGATCGAGTACTCGGGCTGGGACAATGATGAGCTCAACGAGGAGGAGG
AGGACGAAACCGTAGTGCGTATGCGGGTCCGTACGAGATCTTTTTCTTGG
TCCTCTGCAGCTACTTTTCCCGCCAGTCGACGGGCGGAATCACTGCTCGC
GGTGGCAAATGATAATCTACAGATTGTGCTTTTCAGGATCACGCACGACC
ATTGTTCGATCGTAGAGTTTTTCAAGGGCATTGATTTAGAGATCGTGAGA
AAAGTTGGGTTAAGAGAGACGTGGGTGAGTTGCCTTGCATGGAGTCCATG
GAAACGGGTCCGAGGTGGCGACGAAGGAGACAATCACAAAAGCAAAGCCT
TCCTGGCCTACGGATTTCGCGGAAAGGTGTACATTTGCCCGATCACCGTG
TCCCTCGAGTCGGGAGATTACTCACACTCTCCCGGGAATCATAATCTGTC
GGCTGTGGCTGGAAATAGACTTGTTGTTGGGAACTCGATATCTGACGTTC
ATCTGGTTTCTGCCATAACTTGGGCTGAAGAGGAGATCAGTGGGTGCCTT
ATTCTGGCCTATGTTATTCCACGCAGCGTAAAGATTGTCGCTATCAGCAG
CGATGGGAGGGTCAGGTCCACCAGGGAGTTTGTGAATGGCTTTGTGGATC
ATATTGCCGGGTTTTGTTTCACTCCCTCAACAAGTCCCTCGCGGGTCATG
CTCCACCTTGCCAGTTCCAATGGAAGGACGCAAATCATCGACTACACGAG
CGAAAAGTCAACCTCTCGCATCACGGAAGGCGCCGGCGACGAACAAGATG
TGCCGATGCGTGACGCCCCGCCGGGAAGTAAGGAAGAAGAGGAGGAGCTC
CGCGCTATTGCTTCCCGTTGGACGAACGTACTGGAGGAGAGGAAGCAAGA
CTACATGGCTGAGCATGATCTATCCACTTGCACTTCCAGAGTGTATGGCA
TCGCGGCAAGCCCCATGGGTGGGATTATCGCTGTGGCTTGCAGCTTCCAT
CCGAATGACAGTCTGCAGTATATCACGGCATCTAAGGAGATGACCAAGAT
AGTCTTCGGCACACACCCCGGGTGGGAGGGCGCCTGGCAGAGGAGAGGCC
TTCTGGCTGAGCCCCCTTCAGACGAGCCGCAGGTGCCCACCCCCGTAGAG
ATCTCGAGTGAAGCATTTCTCTTCGAAATCGAGTGCTTTGGGGGTAGAAG
CGCAGGTATTGCGGACAGGATCCGAAAGTCATTGGATAAAGTACACTTCC
AAGATGGTAATGGCTGGGACCTAAAGAGCATATCGATAGACGGTGCTGGG
GTCGATGCTTCCTTGGCTTCCAATCTTTTGGCTAAACGAGAGCTAAACGC
GCTCCGGTACAAATGCTGCCTGCAAACATTATCAGACCCCGCCAATCCTC
GCTTATCTCTCCTTATCAACACCCCTCCAAGAGAATATCCAGAAATAATC
GCTCATATCATCTGCAACATTCTATCCGTTCCCCGAAATAGCGCGACCGA
AAAGTCCAACCTGAGCATCAGAATAATATACTCTCTCGCATGTATCGGAA
TTCTAGGACTGTACAATTTCCGCCAAATAGTAGAGCTCGCACAAAAATCA
TTCCTCTGGCTATCGACAAAAGTCAAAGTGGACGTGCGCACAGAACTGGA
AATTTCGGAACGTAGAATATCAGATCTGGACGTTATGGAGCGCGGAGAGG
ACGATGGCTCGGGCCTGCAGGAGATCCGCGATAGGGATAAAGGCTTCGCG
AGTAGGCTGGAGAAGTGTGCCCTGTGCGACCAGGGGATGACATGGTCCGA
TCTTAGAGTGGCCGAGTGCTCACTTGGACACAGAGTTTCTAGATGCACAC
TTACCTTTCTGCCAATGAAGGACTATAAACTCACCAAAGAGTGCATGGTC
TGCAAGCGGACGGTTCTATCAGAAGCAGTTCTTGTCCAGGAGATGGAAAA
TAATGGTGCGCATAAGAATAACGGCGGTGACGGCGGCGGCAGCAGCGGAC
TGGGAGA

Sequences in the Contig:

SY0AAB31YC16FM1 SY0AAC21YB16FM1 SY0AAC22YH15FM1
SY0AAC29YE12FM1 SY0AAC30YD12FM1 SY0AAC35YJ07FM1
SY0AAC38YO11FM1 SY0AAC41YP09FM1 SY0AAC43YK10FM1
SY0AAD11YB01FM1 SY0AAD35YH12FM1 SY0AAD36YB01FM1
SY0AAD44YG01FM1 SY0AAD47YE03FM1 SY0AAD59YC05FM1