Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4274
Length(NT) : 821
Best Gene Model Blast : Link to GSTUMT00005390001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001246361.1| Score: 497 E_value: 2e-48
KEGG Definition: mitogen-activated protein kinase MAF1
Accession: afm:AFUA_2G01550 Score: 484 E_value: 3e-47
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3104 Score: 276 E_value: 2e-25
PFAM Definition: Maf1, Maf1 regulator. Maf1 is a negative regulator of RNA polymerase III. It targets the initiation factor TFIIIB..
Pfam Number: pfam09174 Score: 380 E_value: 2e-37
Swissprot: Q6PGU2|MAF1_DANRE

Sequence:
>Contig4274
TTGGCCGCAGCAGGTCTCCAAGGTGAAAAGCCTCTAGTTGATGGAACAAT
GTAGATAAGGGAAGTCGGCAAATATCCCTCTCTCTAGCTATTTCTAAGCT
CATATAACCAACCCTACGCCTCTGAATAACGAACGAACAATCTCGGCGAT
TTAATCAGGAATTCATATCAAGCCCTACTTTCGATAACTTCTTTGCTTCA
CCAGCGACTTTTCAAATACACGCCGACACCAACCCATCGACCGGAGCCAT
GAAGTTCCTTCCTCTTCGCGAGCTTGATTCGATCAATCGTGCTCTCGTCT
TCGACACTCCTGATTGCCGTGTCGTTGGCGGTGTAGACATCTACACCACC
AAGCTTTACAAAAACGTCTGCGAAACTATCAGCACTCGCTATGAAGCCGA
TCTCCGTCTATCGGAGTCCTTATCTCCCCCTGACCGCGGTTCCGATAGCG
CTAGCAAGTACCAGTCTGCTGCCGTTTACCAAACCCTGCATTCCCCGTTT
GGACCTTTGGATCAGATTTCGGCTAGACGCACTTTTGCTTACTTGATTGC
TACCCTTAATGCTTCTCATCCCGACTATGATTTTTCTACCACGCTTCGCC
CATCGGACTTCCGTCGTGAGCGTCACATCAGGCCCGTTATGAACAATTTT
AATACAACGTTGTTCAATTTAGGCGTCAACACCTCCAGAGAGCTTCCCAA
GATGTGGGAGACTATTGATAAGGAGATGGACTTGTTGAATTGCAATATCT
ATGCCTACTCTCCCGACGATGTCTCCAACGATCCGTATGGTGACGAAGGG
CTTATCTGGTCTACTAACCTT

Sequences in the Contig:

SY0AAC29YD09FM1 SY0AAC8YD02FM1