Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4273
Length(NT) : 1163
Best Gene Model Blast : Link to GSTUMT00006245001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: GAL10 bifunctional protein
Accession: ref|XP_957519.1| Score: 1128 E_value: 1e-121
KEGG Definition: hypothetical protein
Accession: ncr:NCU04442.1 Score: 1128 E_value: 1e-121
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG1371 Score: 921 E_value: 1e-100
PFAM Definition: Epimerase, NAD dependent epimerase/dehydratase family. This family of proteins utilise NAD as a cofactor. The proteins in this family use nucleotide-sugar substrates for a variety of chemical reactions..
Pfam Number: pfam01370 Score: 433 E_value: 2e-43
Swissprot: P40801|GAL10_PACTA
Gene Ontology:
GO:0004034 = Molecular function: aldose 1-epimerase activity

Sequence:
>Contig4273
TTGGGCTTCCACCGCTCCCCCCTCTTGACAGCTCAGCAAAACAAAACCTT
CCTGTTCCCGCTGTGTTACTCACGCTTGTTTTCTGCAATCTAATCTTCTG
TTAACAAACTAGGTTGCCCTATTCCTTAACTACCGGTACCAACCTTATCA
GCCTTTTGCCTCTCAGTCACCCCCCCAGCCAAAGATGTCCGCGAAAGAAG
GTACTGTTTTGGTCACTGGCGGGACCGGTTACATTGGGTCCTTTACTACT
TTAGAGCTTCTGGTTGCTGGTTACGAGGTTATTGTTATTGATAACCTCTA
CAACTCTTCGGAGGAGTCCCTAAACCGTATCGAGCGCATCTGTGGCAAAC
GTCCGATATTCTACAAGGCGGACGTAACCGACCAAGAAGCGCTCGACAAA
ATATTCAAAGATCACCCGGATATCGACTCTGTTATTCACTTTGCTGCCTT
GAAGTCTGTTGGAGAGTCTACTGAGATCCCCGTCGAATACTACCGTGTCA
ATGTCGGAGGAACGATCTCTCTCCTCCGCTCCATGGAAGCGAATGGCGTG
AAGAACATTGTTTTTTCCTCTTCAGCTACCGTTTACGGTGACGCTACGAG
GTATCCGAACATGATCCCCATCCCAGAGACTTGCCCCATTGGTCCTACCA
ACCCTTATGGGAGAACCAAGATGATGATCGAGATGGGTATGTTTGTGTTC
GCTCTTTGTAAACTGGCTCCACAGCTCCCTTAAATCGCCAGGGATTTGGC
GCATTGGTACTGATTCACCCCCGTAGTTATCGAGGACCATGTCGAGTCGC
ATCCTGGCTGGAACGCCGCGCTTCTTAGATACTTTAACCCTGCTGGCGCT
CATCCGTCAGGAATCATGGGGGAGGATCCTCAGGGAGTTCCTTACAACCT
TCTACCTTTATTGGGGCAAGTCGCCGTAGGGCGCCGGGAGAAGCTTAAGG
TCTTCGGAACAGATTATGCCTCCCACGACGGTACTGCGATTCGCGACTAC
ATCCACGTTGTTGACCTTGCCAAGGGCCACATCGCAGCTCTGAACAAGCT
TAGGAAAGACAAGCCTGGGTGTCGGGCGTGGAACCTTGGCACCGGAAAAG
GTTCTACAGTCTTTGAAATGATCGGGGCCTTTTCGAAAGCTGTTGGAAGA
GATCTTCCCTATG

Sequences in the Contig:

SY0AAC29YB13FM1 SY0AAC33YI15FM1 SY0AAC6YF21FM1
SY0AAD31YJ16FM1