Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4272
Length(NT) : 687
Best Gene Model Blast : Link to GSTUMT00004616001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_11115
Accession: ref|XP_001550049.1| Score: 749 E_value: 9e-78
KEGG Definition: hypothetical protein
Accession: ncr:NCU04674.1 Score: 735 E_value: 2e-76
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG1065 Score: 519 E_value: 1e-53
PFAM Definition: Glyco_hydro_31, Glycosyl hydrolases family 31. Glycosyl hydrolases are key enzymes of carbohydrate metabolism. Family 31 comprises of enzymes that are, or similar to, alpha- galactosidases..
Pfam Number: pfam01055 Score: 106 E_value: 9e-06
Swissprot: Q653V7|AGLU_ORYSJ
Gene Ontology:
GO:0004558 = Molecular function: alpha-glucosidase activity

Sequence:
>Contig4272
TTGGGGCGGAATTGCAGCTCGCTGGGACTGCCTGTGATATTTATGGTAGG
GACTTGGCAAACTTGAAGCTGCAAGTGGCATACGACTCAAAATCTCGCAT
TCATGTTAAGATAACCGACCCGGAAGAGAAGAGATACCAAGTTCCGGAGG
AAGTATTCCCTCGGCCAGACAACAGAGTCAATGGGCCAGCGAAACCGTCC
GACATTACCTTTACCTATGCCGCTTCCCCCTTCGGTTTCACCATTACCCG
GCGCTCCACTGGCGAGAAGCTGTTCGACACCACTGGGAATGCGCTCGTCT
TCGAGAGCCAGTACTTGCGACTGAAAACCTCTTTGCCCAACGATCCTAAC
ATCTACGGTCTTGGAGAACATTCTGACTCTTTCCGTCTCCCCAATATCAA
TCACACCCGCACCCTCTGGTCTAGAGACTCTTATGGTATTCCGCAGAATA
GCAATCTGTATGGGAACCATCCCATCTACTTCGATCATCGCGAGTCAGGT
ACCCACGGTGTCTTCCTTTTGAACTCCAATGGCATGGACATCAAGCTTGA
GACCGTGGATGGCAAGTCAAGCCTTGAGTATAATGTCATTGGAGGTGTCT
TGGATCTTTACTTCTTTGCTGGCCCTGACCCGGCTGCTGTTGCGAGGCAG
TACGCTGAAGTTGTTGGACTTCCTGCCATGATGCCCT

Sequences in the Contig:

SY0AAC29YB12FM1 SY0AAC54YO22FM1