Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4271
Length(NT) : 688
Best Gene Model Blast : Link to GSTUMT00001869001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: ref|XP_001390583.1| Score: 371 E_value: 3e-57
KEGG Definition: hypothetical protein
Accession: ang:An05g00090 Score: 371 E_value: 1e-57
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3224 Score: 269 E_value: 1e-24
PFAM Definition: TIP41, TIP41-like family. The TOR signalling pathway activates a cell-growth program in response to nutrients. TIP41 interacts with TAP42 and negatively regulates the TOR signaling pathway..
Pfam Number: pfam04176 Score: 238 E_value: 4e-21
Swissprot: Q12199|TIP41_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0007165 = Biological process: signal transduction

Sequence:
>Contig4271
TTGGTCCCTCAACAAACAATAAAGGGATGTCGAGATCACCGCCGCTACAA
ACTGCTCCCAACATCGACGTGGGTAAATCTATTACCCGAGGTGATTGGAA
AGTAACAACTCACAAGCGTCCTATCCTAAATAGCACCGAAATCGAGACCA
TGACTACAACCTTGGGCATCTCGCCTCCCGAGATGATCTTTGGGAACAAC
AGCGTCGAGGTAACCAACGAGAGGCTCAACTGGTCCATTAGTTTTAACGC
GTTGGATGCCCTCGAGCTGGTCGATAAGTCTGGGGAGTCAATGTTAAAAG
TTTCGTACTCTGAAGCATGGCAGAGGATGCGCGAGCGGGTACATGAGGAT
ATCAAGGAGATTGTGAAGCCTTACGATTGGACGTACACTACTAATTACCA
AGGAACTGTTCATGTGGCTACCCCACATTCATCCGCTATGCCCCTCTTCC
TAGATCATAAGAAAACACTAACGCGATCAGAACCCCGATAGGCCATTCCA
ACAGACCGGTAGTGAAATACCCTTCGAGAAGCTCAAGCGCCCTGACCCCA
TTCTCCTCTTTGATGACGTGATGCTTTACGAGGACGAACTTGCCGACAAC
GGCATCTCAATCCTTAGTGTTAAAATCCGCGTGATGCCCGAGCGCCTGCT
CATCCTTCAGCGCTTCTTCATGAGGCTCGATGGTGTTC

Sequences in the Contig:

SY0AAC26YN21FM1 SY0AAC29YB10FM1