Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4270
Length(NT) : 1855
Best Gene Model Blast : Link to GSTUMT00009011001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 113 E_value: 5e-06
PFAM Definition: No Hit Found

Sequence:
>Contig4270
TTGGCGCCAACCCGGCTACCAACATTATTCTCGACCTTATCAAACAAGTC
AACCCCGCCCATACATACAAACTAGAATTTTCAATTGGAAGAGAGGGAAA
AAAATGGCATCATGCCACAACAGCAGCCCCGTGCGATACCTGGCATTGTA
CTGTACAGTACGGAACCTGATAAATCGCGGTTCGGGCCGGGACGGTACGG
GAACGGTATTCCTCGGAACCTCAAAACTAAAAATACGATATTCGCATGTG
CTCTGCCTGGGAGATCATTATGACCTGTACTAAACCATGTATTAAACGCA
GTATGTATATGTATGTACGCACGCTACATACTAAAGCCTTACTTAACGCG
CTCATAAAAGCACGGCGAGAACCACTGCATGGCTTGAAGTGCCTTGCCAT
GGGATCATTCCCCATTATGGGGGATCTGGTTTGTCGGTTTGTCCCGTCCG
TCCATTCCATGGACCGTGGAGGAGGAGATGGAGGAGGGGAAGAGGGGAAC
AAACATGGTAGCCCTAACTTCTCAATTCCTTTAATTTTTTGCTTCCCCTT
TTTTCTTTTTTCTATTCTTGCTTGTGAAGGGACGGGAGTTGTATATGTAG
GAATCACATATCCCCCCCTCCTTCATCCCTCTGTACCTCTGCGATAACGA
ATTCTGGAAAAGAAAGGGAAAAAATGGTGAGGTCCTCTTGGTTATTTTTT
GTGTTGTCCTTGCTCGCAGGATTTGTCTGGACAAGTCCGTCTCCGACCGA
CTCAATCGAGGAAGACATAGAATACTCCTCCAGCCCCCAGGCCAAATTCT
TGAAACAGCAGTACAAGTTATGCCCTGGCCCGGACCACGGGCTATTGAGA
GCCAAGAATCCATTCTTGGTACAAGTGGGTTGGTAGTTACTACGATGGCA
CTATCGAGACAACAGTAACCCTCTCAAACGCCTCGATAACTTGCGCCTCG
CAAGCCGGTACCTTCAACAGAACCCTATCCGCCGTCCTCTCAATCCTAGA
CAACAGGTACCAAACCGTGCCCGACAACGTGCAGAAGAGCCCCTTCATAT
TCCTGCTGAACGCATGGATCCCGGATCTGCCGTTCTCTGGGGAGAATCTG
GTACCCAGCCAGATGCCGGCGGGGGTACTCATGGACTTTGAAAGCGTTTC
CGCCTTCAGAGCCGAGAGCAATGGCGGGAAGTACGGCGACGCGAGCGCCC
CCTCAGTCGTGGACCTAAACGTCGGAAGCAGCGGCGGGGGCTGGTCGTTC
GTGGGGAGTTACGAGAATTCCACAGATAAGCGACTAGGTGTAGATACCTC
CACGTTCGTCTACGAATTCCCAACCTGTAACGCGACGCAGTACGCGAACT
TTCTCATGCAGAATTACCCCGCTACCGCCGATTCCCCCGCCATCACCGCC
AACACCAACACCACGACCACCACGCTCAATGGCACCTTCTCCCCCTCGAC
CGCGGAGTTGACCATTTCCGGCCAGTTCGCCGGGCACTTCGATTCGTGGA
GGCTGGGCGATCACAAAATCGACATAGCGCGGGATAAAGTTCAGTACGGG
AGCTACAAGGTGGTGTTCAAGGGCGTTCTGGATGCTAAGCATTCGCACAA
CTTGACGGTCGGGAGCGCGCCGAGCTGGGTGCCGGACGTTAACAAGACCA
TAGAGTACGCTTGCGTGCAGAGGGGAGCCGGGGCAAGGAGTAGGGAAGTG
GTGTGGTGGGGTTGGTTGGCTCTTGACGTCCTCCTTTTGACGCTTTGGTC
GTGGCTGTAAACGGGTCGTTCCGTTTATATATATATATATATAATTATGT
GTAATTCCCTGTATCATATAAAGGTTTGTGCCGGTTAAGGCCATCATCAA
AAGTC

Sequences in the Contig:

SY0AAA25YC13FM1 SY0AAA25YC13RM1 SY0AAB52YM07FM1
SY0AAC29YB01FM1 SY0AAC51YE04FM1 SY0AAD2YP09FM1
SY0AAD35YD09FM1 SY0AAD9YK14FM1