Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig427
Length(NT) : 680
Best Gene Model Blast : Link to GSTUMT00007115001 E-value : 4e-88
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig427
TTGGGCAGGGCTGAAGTAGTGAGTGAGAGGGAAAACATGACGAAGAATTG
GGACAGCGTTAAGGTTAAGCTTCATGAGTTGTGAGTCTTGCGGAATCGAA
TCGGACAGTGGACGAATTGAGGGATGGGTTGGAGGGAGAATGGAAGGCTG
ACAGGAAGTGGTGAAAAGATACATGGAGAAAAACCTCAAGCTCGATGATA
TGATTCGGATTATGAAGGAGTCTTATGATTTTGGTGCGAGCCCCCGTGGA
TACAAGAAGAAATTCAAGCAGTGGGGATGGTTAAAAAATGCCCCGATCCA
GGGCGAAGGCCTTCTAGACGAGCCGTCGCTAGTCCACCAGATGACAATTC
GGGCCTAGAAATACTCAGCGATGTCGCGGCAGGAAGCCAGCACTCGCCGA
AAGAATTTACAAATGCTGTCGATGGCGGGGGAAACTTTGAGGTGTGCTGT
TTGTTTTGTGGCAACATATCACCCTAGAAGTTGGCTTCGGTTGGTTGATT
GCTGACTTTTGGTTGATCGACCGACCGATTAGCCGGCGCAAGCGACCGAC
GGACCGACCCCCGGATACCACAACAGGTACCCGCCGATAGACATAGCTCC
GCAAGTCCCCGCCCGGACAGACACCGCCCGCGGGAGGGAAACTCCTGTAA
ATCCTTTCACCCAAGCTTTGCCGACGTCCC

Sequences in the Contig:

SY0AAA23YN15FM1 SY0AAA24YN15FM2 SY0AAB61YB17FM1