Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4269
Length(NT) : 1719
Best Gene Model Blast : Link to GSTUMT00002612001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: unnamed protein product
Accession: emb|CAD60580.1| Score: 1227 E_value: 1e-132
KEGG Definition: hypothetical protein
Accession: mgr:MGG_09238 Score: 1162 E_value: 1e-125
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG1371 Score: 128 E_value: 7e-08
PFAM Definition: RmlD_sub_bind, RmlD substrate binding domain. L-rhanmose is a saccharide required for the virulence of some bacteria. Its precursor, dTDP-L-rhanmose, is synthesised by four different enzymes the final one of which is RmlD. The RmlD substrate binding domain is responsible for binding a sugar nucleotide..
Pfam Number: pfam04321 Score: 188 E_value: 1e-14
Swissprot: Q9SYM5|RHM1_ARATH
Gene Ontology:
GO:0005625 = Cellular component: soluble fraction
GO:0050377 = Molecular function: UDP-glucose 4,6-dehydratase activity
GO:0010280 = Molecular function: UDP-L-rhamnose synthase activity
GO:0010253 = Biological process: UDP-rhamnose biosynthetic process

Sequence:
>Contig4269
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCACCTTGTGTGAGCTATTC
TGCCGCGCACTAGACCCCAGAACCTTCCTCTGACAGCTCCGCTCCTTCCC
CGCTTACCCTATTCTTCCTTCTCAACCATCTCCTCGCTCTCATCAATTGA
TCACTTGCTCCTCCAAATATCTTTTTTTCCTCCGCCCTGTATCTTGTTTA
TTAACAATATGGCTCTCGCAACACCAAAACACAAATTTTTGGTCTGGGGA
GGAAATGGATGGGTTGCTGGCCACTTGAAGACAATTCTCGAAAGTCAGGG
CAAAGAGGTTCTGACCACAACTGTGAGAATGGAAGACCGCGAATCCGTTC
TAAAGCTGCTTGATGAGGTCAAGCCTACCCATGTTCTCAACGCTGCTGGT
TGCACCGGAAGACCTAATGTCGATTGGTGCGAGGATAACAAGGAGGCTAC
CATTCGTTCTAATGTGATTGGTACCTTGAACCTGACCGATTGCTGTTTCT
TGAGAAAAATCCATTGTACCGTGTTTGCCACCGGATGCGTTTACCACTAC
GACGATAAGCATCCCATTGGTGGCGCAAGTTTCAAGGAGGAAGATCCAGC
GAACTTTGATGGATCTTTCTACTCGGCTACCAAGTCCAGGGTTGAGGAGA
TCTTGATCCACTATCCCAATGTCTTGATCCTTAGACTTAGGATGCCCGTT
TCGGATGACTTGCACGGAAGAAACTTTGTTACTAAGATTACCAAATATGA
CCGAGTTGTTGATATCCCTAACTCAAACACAATCCTCACAGACCTCCTTC
CGGCGTCCATCATTCTTGCTGAGAACAATGAGCTTGGAGTTTATAACTTT
ACCAACCCTGGCGCTATTTCGCACAACGAAGTTCTTGCTCTGTTCAAGAA
GCATGTCCGCCCTTCTTTTGAATGGAAGAACTTCTCTGTTGAGGAGCAGA
GTAAGGTTATCAAGGCTGGCAGGTCTAACTGTGAACTTGACTCCACCAAG
CTCGTCAACAAGCTCAAGGAATACAACTACACGGTCCCCGAAATTCATGA
GGCTTATGAGCAGTGCTTCATTCGTATGGCTAAGAATGGAGAGAAATAGG
CTACCGATTCGAGGAGCTGCTGATTCCAACCCTTTATTGTTCTTTGTAGT
TTGGAATTTTATTTCTGTTGAGCTGAATAGCGAACATGGAAGGTACATAG
TGTGGAATTGGGCGGTTTTATGGTGAAGTTCTGACCTTTGTCGTAATTGA
AACATCCCCCGCCCGGAGAGTAGATCGTACGGGTGTTTTGGTTGAACCTG
TTGTACTAACTCACAAGCCCCTCTAGCTGAATGATCCAAGCCCTTGCCTA
TCCCAGAGGCTCTTTTCTAGGGTGTTCCAGTGCTCGAGACTGTTACATGA
GCATTTGTATTTTAGAGGATCCCTAGGAAGAAATATAATCAAAGGGTAAA
CAGGAGCTCGGTATTATCTGTCCTGTAGGCCTTAATATTATACTTTACAA
ACTTGACAACATCCGTCGCCCACCCACCCACCATTTCACAGCAGAAATGG
CATTTTCATCCTGCAAAGCCCTAGCCTTACGCAATCCCAAAAATTATGCT
TAGTCTATGTGAATACTTCCGTTACTAAATACTAAATACATGTTAGCAGA
AGTAATGGTAGTAGATGAAAGGTCATGCAACATACACGACTTTTCTATAT
AAAAGGTACCGCCACATTC

Sequences in the Contig:

SY0AAA11YI06FM1 SY0AAA17YL13FM1 SY0AAA31YC10FM1
SY0AAA43YI19FM1 SY0AAA45YI10FM1 SY0AAB15YG20FM1
SY0AAB18YD21FM1 SY0AAB1YL17FM1 SY0AAB34YN14FM1
SY0AAB39YH20FM1 SY0AAB42YO20FM1 SY0AAB61YD19FM1
SY0AAB7YA01FM1 SY0AAB7YL04FM1 SY0AAC21YB23FM1
SY0AAC29YA21FM1 SY0AAD49YL12FM1 SY0AAD4YM22FM1