Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4268
Length(NT) : 679
Best Gene Model Blast : Link to GSTUMT00011357001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SS1G_13748
Accession: ref|XP_001585180.1| Score: 395 E_value: 9e-37
KEGG Definition: hypothetical protein
Accession: fgr:FG09800.1 Score: 362 E_value: 3e-33
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2830 Score: 283 E_value: 3e-26
PFAM Definition: TAP42, TAP42-like family. The TOR signalling pathway activates a cell-growth program in response to nutrients. TIP41 (PFAM:PF04176) interacts with TAP42 and negatively regulates the TOR signaling pathway..
Pfam Number: pfam04177 Score: 255 E_value: 4e-23
Swissprot: Q9Y7T1|YCJ5_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4268
TTGGGCATCAAAATATCACCAACCCTTCACCACCCTAAACCGTCAGGGCT
GCCATGAGCGAGAACCAGGAGTCACTTCGGTCGTTGTATGATTCTGGGGA
ACGCCTTCGGAAAGAGATCGAGGAATCGTACGATTACAATAGTCCCGCTT
ACCAACAGAAATTGCAGACCGCTATCCGAACATACCAGGAATGCAAGAAA
CTTGTTGATCAAATATCTCTATTCAGCACAAATGAGTCATTAGAAGACGT
TGTGTCATCAGAGATAAGATACATGCTTATAGACTATCACTTCGCCGATC
TCACTTCCAAGCAACAGTCGCCGGATCGCGCTTCTATATTGAAACTGTCC
AAGTTCCTATATATGAGATTTTTAAATCTATGCGACGCTTATGATCTACT
GTCAAATTATGATAGAAGCGTACTTCACCCGGCTGATCCAGAAGCACCCA
AAGCCTCTCCCGCCCCCATTGACGCAGCAGCAAGGAGGAACGAGAAGATT
GCGAAATTTAAGCTGGAAAAAGAATTGAAAACTAAAATCGATGCGCTTGC
CCAGAATCCTCACTTATTGGATGAAGATGAGTTACGGAAACTTCAGACTG
CATTAATGTCATTGGCAATAATGAAGAGCATTCAACAACTTGAGATGATT
GAGCTTGAACTTGATATTCTTAGCAAAGC

Sequences in the Contig:

SY0AAA11YH05FM1 SY0AAB54YK12FM1 SY0AAC26YN07FM1
SY0AAC29YA09FM1 SY0AAC47YN22FM1