Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4265
Length(NT) : 915
Best Gene Model Blast : Link to GSTUMT00006454001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_07369
Accession: ref|XP_001554232.1| Score: 345 E_value: 1e-30
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G07902 Score: 321 E_value: 3e-28
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4265
TTGGTTAACTTTCTTTTACTACTACTGCAGCCCATGTTTCAATCACCCCG
CTGCTCTTAATATCGACTGCCTTCCCATTTTCAGTCACTCCCTGATATCG
TGGAAGAAAGGAAAGGGTCTGGCAGAGCCTTCTAAGGGCGATTAGTATCC
GGCCATGTATCTTGACCGCCCCTTCGTTCTCCATGCACTGCTTGTGCTTT
CACTTTTCTGTGGAATTGCTCTATCCGGAGGAGAAAACATACATCGCCGT
CAGGATGGAAATGTTGCGCTGACGACTTCAAACAATAGACCCTCAGCAGA
TGCCGAGGTTGTGGATCAGACATCTATCTCTCGCGCAGCCACAAACACGG
CCTCAAATGCTCCATCGTCCACGAGAAATGCTCAGAGCTCAGATCCTAGC
CCAACATCCGGGGGAAAGAATGCTGGTGAGACGATCAAGAGCTCCCCCGC
GCCTACTATGGCCGAGAGTGGGGACAACTTAAGCTTAAACACAAACCCAG
CAGATGAAATCTACCAGGGAGGTTTGCCAATAGATCCTACAATAACACCT
GGGATTGCAGTTGCGGGCGTGTTGCTTTTACTTGCTGGCATACCGTACTG
CTTAATTGGAATTAAAATCAAATTCCTGCATATTTTCCTATCTACAGCTT
TGTTAGCTAGTTTGGGTGTTACGGTCCTTGTTGTTTACGTCATGAATCCG
CCGGTTAAATTCGCAATCCAGGGGGCCTATGTTACAGCTGCAACGATCAC
TGGTCTTCTGACAGGTAGTTTGGCTGTTGTGTTTCCCGAAGTTACAGAAG
CCCTGGGCTGTTTGTTGGGCGGCTTTTGTGTTTCCATGTGGTTCCTTGTA
TTGAAACCCGGAGGGCTGGTGGCATCCGTTTACGGCAAGCTTATCCTAAT
TGCTGTCTTTTGTTT

Sequences in the Contig:

SY0AAC27YC06FM1 SY0AAC28YP19FM1