Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4264
Length(NT) : 469
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 164 E_value: 9e-13
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 139 E_value: 6e-10

Sequence:
>Contig4264
TTGGTTGTACTTTAGAGGTGAAATTGGATATATACTCTCCTTTCCTGCGG
GTAAATCGACCTTCCTTCTGGCAATTGGCGCAGGTGCTTTTCTCGTATCA
TAGAATTTTTTTTTTCTTGTCGCGATACCGGTAGTAGTGATACAAGTATT
ATGATACGGGATTTGGAGGCTCTGCTGCCTGCCGTGATCGACGACGTCAA
CTCACCCGGCCAACCGGCGGCTCTCATGTTCCACACACCGAACAACAACC
TGAAAAGCGCGGCTAGAGAATTCTCCAGCCTCTTCCACCTTCCTGCTAGA
TCAACCAGAACTCACAGCAATGGATAACTACCCCCTCGAAGCTCCCCCTC
CCCCTCCGTCATCGCCGCCACCTCCGCCCCCTCCAGATTCCACGGTACCT
CCTCCACCGCCAACTGAAGAACCTCCTCCACCACCACCCGTTGAACTACC
TCCCCCACCCCCGCCGAAA

Sequences in the Contig:

SY0AAA7YF06FM1 SY0AAC28YP18FM1