Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4261
Length(NT) : 780
Best Gene Model Blast : Link to GSTUMT00001018001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001243067.1| Score: 453 E_value: 2e-43
KEGG Definition: 60s ribosomal protein L6; K02934 large subunit ribosomal protein L6e
Accession: aor:AO090038000295 Score: 447 E_value: 6e-43
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1694 Score: 301 E_value: 3e-28
PFAM Definition: Ribosomal_L6e, Ribosomal protein L6e..
Pfam Number: pfam01159 Score: 354 E_value: 2e-34
Swissprot: Q9C9C5|RL63_ARATH

Sequence:
>Contig4261
TTGGCACATGCCCAACCAAAAAGTACGCACGGAATCCTCCAAAGTGAATT
CTAGCCTCCCCAACAGCACCAAGCGACGACGACGAACTCCCCCCAACAAT
CACCCATCGATATTTCAGCAATGTCGGCAGAGAACAAGCAGGTCACGTTT
GGGTCCGGGAAGAGGGAAATTCCTGCTCAGAAGGCGAGCAAGTGGTACCC
TGCTGAAGATGAACCAGTCAACAAGAAGGTTCGCAAAACCCAGAAACCCA
CCACCCTCCGCCCCTCTCTCAAACCCGGTGCGGTGCTCATCATCCTCGCC
GGCCGATTCCGTGGAAAGCGCGTCGTCTACCTGAAACCCCTCTCTGGCGG
TGTCATCCTCGTTACCGGCCCCTTCAAGCTCAACGGCGTTCCCCTCCGCC
GTGTAAACTCCCGCTACGTAATTGCAACCTCCACTATCGTCGACATCACA
GGCGTTCAGTTGGATAAGTTTGACGAGAAGTACTTTGCCAAAGACAAGGA
GGCTAAGAAATCCAAGGAGGAAAAGTTTTTTGAGGCAGGAAAGAAGCCTG
AGAAGAAGCCCGTCCCCGAAGTTCGCAAAGCCGACCAAAAAGAGATCGAC
GCAGCTGTCACAAAGGCCATTAAGCAAACCCCCCACCTTTCGGCTTATAT
CAGCTCGACTTTTTCCTTGAGCAAAGGCGACAGACCACATCTCATGAAGT
TTTAGATTCTCTCTTAGTTCTCCCTTTCATCCTGTTTTTTTAACTAGCTC
GACCCTTTTTAAAAAAACTTTTCTTCACAT

Sequences in the Contig:

SY0AAA48YN18FM1 SY0AAB11YN12FM1 SY0AAB45YN09FM1
SY0AAB55YH07FM1 SY0AAC28YO22FM1 SY0AAC28YO22RM1
SY0AAD56YF14FM1 SY0AAD9YD12FM1