Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4260
Length(NT) : 1595
Best Gene Model Blast : Link to GSTUMT00009630001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: oxidoreductin
Accession: ref|XP_001262060.1| Score: 755 E_value: 7e-78
KEGG Definition: hypothetical protein
Accession: ang:An16g07620 Score: 750 E_value: 1e-77
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2608 Score: 483 E_value: 4e-49
PFAM Definition: ERO1, Endoplasmic Reticulum Oxidoreductin 1 (ERO1). Members of this family are required for the formation of disulphide bonds in the ER..
Pfam Number: pfam04137 Score: 460 E_value: 2e-46
Swissprot: Q7SEY9|ERO1_NEUCR

Sequence:
>Contig4260
TTGGAGACGTCCCGCATCAAACTGGTACCATACACAAGCGGCAACGGGGA
ATCTCGTCAGAGAAATTCCAATTTAGCGAATAACCCACATCCCATGTCCC
AATTCTGGGTTTGCACCGACAAGCATCATGTCTGTGTGCTCGAGTAGGGG
AGGTTGTCGGTCATCCCTCGTTTCACATTTCCTCGAACTATGACACCGTG
GCCTTCGGCTTACATAGGAGAGTGAAGTGAAGAATGGGTGGGGAAATTCT
GGAAAAATACTAATGCTGACAGACAGGAACAGGATCAGCTTTGAAACCGT
TTTAAATACCTTTAGTGGCACGGTTTCTGAGTCGATGGCTCGACCTTTTG
GTGCTCCTCATCCCACCTCGTTTGTCGTTTGACAGGAGGAACCATCTTAA
TCCTGCTTAAACGCTGCAGCCCTACCGCTCGTTCGATTTGTCTTCCGACC
CATCGCTGTCCAAACTCCCTCAGTATATCTGGCCTTTCCTCAGCCTACGC
TCCTTTAACTATTCTCTACATTTCCCGTTTCTCTTGCCCTGACTTCTCAG
GAATCGATAGGCTGTGCCTTTTCCGCCCAGTGTGTTTTCCTCGGAGCGAT
TATCTACTGTTACATCCTCGCCATCCGGCATTCGTGTCCTACACAACCTT
TAACTCTTCGGCGAAGAGCACCAAGAATAATGCGTGCACAACATCCACAG
CAGCTGTTTGCCGCGCTAATCATATCTGTATCCACAATTGTAGACGCAAA
GCATTCAATCTGCCCTAATAAACCTAATGAACTGGTACCCGACGGATGTG
CATCTTATTCAACAATCGAGGAATTAAACAAGAAGCTTTACCCACTTGTT
AACGATATAACCCAAGAAACGGACTACTTTGGCTATTACCGGCTCGATCT
ATTTGGCCGAATATGTCCATTCTGGTCTGACGATGAAGGAATGTGCGGCA
ACATCGCATGTGCTGTAACGACGGTTGACGAGAAGAATATTCCTCCGATA
TGGCGAGCGGAAGAGCTTGGGAAGTTGGCAGGCCCTAAAGCAAGTCACCC
AGCGACCAGACAGCCGGATGAGCCATCTCCATTGGCTGGTGCATTGGGCG
AGGAGACCGAGGAGAGCTGTGTTGTTGAGGAGGACGAATGCGATGAGAGG
GATTACTGTTTACCTGAGGATGAGTCGGCTGGTGGGAAGGGCGATTACGT
CAGTTTGACGGAGAATCCAGAGAGGTTCACTGGGTACGCGGGAGTGGGAG
CGGCGAACGTCTGGAAGGCGATCTACCGGGAGAACTGCTTTTCGAAACCA
CGCGGGGAGAGCTCGCTTGGTTCTGCCGGGGGTTTTGTGGGGGCTGGTGG
GAATGGATTCCAGGGATTCGCCCCCCCGGGAAACCAGGCCGCGATGGGAT
TTGTGAATGTCATGCAGTACAAAGGGAAGCTTGATCTCAACGATCTGGAG
GTTGACGATGAGTGCTTGGAGAAGCGAGTCTTCCATAGAGTTATCTCGGG
GATGCACGCCAGTATCTCAATGCATCTTTGCTGGGACTACCTTAACCAGT
CCACTGGAGAGTGGTCGCCCAACCTTAGCTGTTTCGTCAACCGCT

Sequences in the Contig:

SY0AAA24YJ12FM1 SY0AAA24YJ12FM2 SY0AAA31YJ09FM1
SY0AAA39YD10FM1 SY0AAC28YO15FM1 SY0AAC43YA14FM1
SY0AAC44YH21FM1 SY0AAC8YP22FM1