Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig426
Length(NT) : 687
Best Gene Model Blast : Link to GSTUMT00002873001 E-value : 1e-157
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN5568.2
Accession: ref|XP_663172.1| Score: 329 E_value: 4e-29
KEGG Definition: hypothetical protein
Accession: ani:AN5568.2 Score: 329 E_value: 2e-29
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig426
TTGGCTAGAGCCTTGACCTTGCTGGCCCCTCCTTCCCCCCTACCGCTGAC
TTGAAACCTCCTCCGGTTTGACTGCTATAAAGAAGGCCTATCCTTCCCCG
AGGCCTCACGATGCCAGAAGTTGCCACACATACCTTCAAAGAATATCACA
ACGACATCTGCCAGTCGTCCGATTGTACCATTGCCCTTCCACCCACTTAT
CAACGGATCCATCGAGCCTTCTCTTCGCCAGCTCTGGTTCCTGCTCGCAC
TATTGGGAGAATGGGGATTCACTACGAAGACTCGATGATTTTTGAGAAAG
GACGGGCCCCGATAGAACTCCTACCCGTGGAGATTTTTGGTTGGTTTTTT
GTGCTGTCATTCATCTCGTCCCCCAATACCGGTTGTCGTCACGCTGACTT
TACCAAAAGATCAAATCATCCCACAATTAGTGACCGATGTGCCTACCAAC
GGCTATAGCCCTAGGAACAAAGATTTGGCATCGTGCTTACTCGTCTCCCG
GACCTTCCACATTGCCACTCTGTCGACCTTGTATTCTAAGGTTGCCTTCC
CTCATTCGTTCATCTTCGAAAAGTTCCTGGCGCAGATCTCCAAGTATCCC
GAGCTGGGCCATTTGGTGAAGAGGCTGGACTTCTCCCACTTTACTTCTGT
GGGCTTTGGTAGAACTGAGCGTATGAATTCTGAGATT

Sequences in the Contig:

SY0AAA23YM19FM1 SY0AAC53YM12FM1 SY0AAC56YG01FM1