Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4259
Length(NT) : 929
Best Gene Model Blast : Link to GSTUMT00000846001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: serine/threonine protein kinase, putative
Accession: ref|XP_001276576.1| Score: 578 E_value: 9e-75
KEGG Definition: serine/threonine protein kinase, putative [EC:2.7.11.1]; K08856 serine/threonine kinase 16
Accession: afm:AFUA_8G04670 Score: 582 E_value: 2e-58
KOG Definition:
Classification: [Transcription, Lipid transport and metabolism, Signal transduction mechanisms].
Kog Number: KOG2345 Score: 344 E_value: 3e-33
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 172 E_value: 3e-13
Swissprot: Q12003|KP236_YEAST
Gene Ontology:
GO:0000329 = Cellular component: membrane of vacuole with cell cycle-correlated morphology
GO:0042802 = Molecular function: identical protein binding

Sequence:
>Contig4259
TTGGCAACACCATACCGATACCCCCTTTCCAGCCAACCAGCCAACGGGCA
AGCAAGCAAACGAACAAATACACCTCCACGAACCACCAACTAATAAGCTA
TCCGAAAAACTTTCCCTGTTAATCGATTGATGAGATTGTAAGGAAACACA
CCAATCCAAGATGGCGCAATACTTCCTGGACCTGGTTTATTCCCTTACCA
CCTGCATGTCCTGCTTCCCCTCGTCACCGAACTTAACCATAAACCATCGA
TCATTCAAGATCCTGCGATTGCTCGGTGAGGGCGGGTTCAGCTATGTCTA
TCTGGTACAAGATAACGCAGGGGCTTTGTATGCTCTTAAGAAAATTCGCT
GCCCTTTCGGTCAAGAATCTGTCCAACGCGCTATGAAAGAGGTCGAAGCG
TACAAACTCTTCAATCATGAAAACGTGATAAAATCCGTCGATTACACAAT
TACTAGCGACCGTTCGGCGAGTACCACCCTGGGCCGCAGCGATGATGGCG
ATGACGGATCGCAGAAAACGGTTTACATATTGCTACCGTACTTCCGTCGA
GGGAATCTACAAGACGCCATCAACGCAAACTTGATCAACCACACTATCTT
TCCGGAGGGCAGGCTAATGCGGCTGTTCCTGGGTGTATGTCGGGGACTAC
AGGCCTTACATGAACACCGTTTGAAGCGGCCCGGCGAGGTGCGTGCTGGT
GCCGGCGCAACAGCAGGAGGAGGATCGGACGAAACCACAGAGCCCCTAAT
GACCCCCGACGTCCTCTCCACCCAAGAGGGTGGGCCAAGAAGGCGACATA
AGAGCCTACGCCCACCGCGACATAAAGCCCGGAAACGTAATGATAGACGA
TGACGGTCTCCGTCCAATACTTATGGACTTCGGCTCCATGACGCCAGCGC
CCACACCAATAACATCCCGCACGCTAGCC

Sequences in the Contig:

SY0AAA63YK18FM1 SY0AAC28YO03FM1 SY0AAC29YG18FM1
SY0AAC38YL06FM1