Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4258
Length(NT) : 729
Best Gene Model Blast : Link to GSTUMT00006122001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: UPF0220 domain protein
Accession: ref|XP_001270071.1| Score: 427 E_value: 2e-40
KEGG Definition: hypothetical protein
Accession: ang:An15g00540 Score: 413 E_value: 4e-39
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3393 Score: 368 E_value: 4e-36
PFAM Definition: UPF0220, Uncharacterised protein family (UPF0220). This family of proteins is functionally uncharacterised..
Pfam Number: pfam05255 Score: 436 E_value: 6e-44
Swissprot: Q12016|VPS68_YEAST
Gene Ontology:
GO:0016021 = Cellular component: integral to membrane
GO:0000329 = Cellular component: membrane of vacuole with cell cycle-correlated morphology
GO:0005739 = Cellular component: mitochondrion
GO:0005515 = Molecular function: protein binding
GO:0006623 = Biological process: protein targeting to vacuole

Sequence:
>Contig4258
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCAGCTTTCCTTCCCAACCCCGCCATCATCGCTAAACTCAGCTC
ACGAGCTTCAGCACTACACCAAAAACCCAAGCAAACCACCAAAAAAGAAG
AAAAAGAAGAAGAAGAAGGAAAAAAAAACACTAGCCATGTCCCGTCTCTG
GCGCTTCCCAGTCCCCAAACTCCCCTCCTCCGCTGTACTCCGTACCGCAG
GCGTATACACCTCCGGAGCCCTCTTCTCCCTCGGCTTCTTCCTCCTCCTG
GACGCGTCGGTCTACAGCAAGCACGCGAACGGCGGCGACGTGCACATCAC
CATAGTGGACTGGATCCCGCTCATCTGCAGCATCCTAGGCATGCTCGTCA
TCAACTCCATCGAGCGCAGCCGGCTCGTCGCCGACAGCTACAGTTACAGC
GGCAACGGCGTCGCTTGGAAGGCGAAGTTGGTGCTCTTCATGGGTTTCGC
CCTCATGGCCGGCGGACTCGCGGGAGCCGCCACCGTGCTCATCATGAAGT
ACGTCGTGCCCGCATACCCCTGGCCCACCCTGGGATTCGGGGTCGCGGGG
GTCGTGGGGAGCGCTTGCGTCATGCTTTCCTCAGTCGTGCTTTGGGTGTC
GCAGAATATTGAGGAGGATTATACGTATAATCTTTCGTTGTAGAAGGGGT
TTTCCTTTTTTTTTTTTCCCTTTTGGAGT

Sequences in the Contig:

SY0AAB50YC15FM1 SY0AAC28YN24FM1 SY0AAC53YO06FM1