Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4255
Length(NT) : 604
Best Gene Model Blast : Link to GSTUMT00011415001 E-value : 1e-115
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG05615.1
Accession: ref|XP_385791.1| Score: 306 E_value: 3e-32
KEGG Definition: hypothetical protein
Accession: fgr:FG05615.1 Score: 306 E_value: 2e-32
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG1370 Score: 344 E_value: 2e-33
PFAM Definition: AdoHcyase, S-adenosyl-L-homocysteine hydrolase..
Pfam Number: pfam05221 Score: 351 E_value: 2e-34
Swissprot: O13639|SAHH_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig4255
TTGGACCAACCTCAACCAACCTTCTCTCGTCCTTAAAACTCCTGGATCCC
TAGCCTGTGGACTTCTCTCCTCCCTTCCTCCGCCCATCCCACACTTTCAC
CGACACAAACCCAACAACAATTCTTTCCCACCTCTACCAACTCGAATTAA
TCAAACAAACATGTCAGCCCCCGCTACCAAGTACAAGGTCGCTGATATCG
TGAGTATCACCCGAAACCCGGCCCAATTCAATTTATACTACCATTGCGGC
GAATGCTGATTTGTTTCGCCTCCAGTCCCTTGCGGCCTTCGGTCGTCGTG
AGATTGAGTTGGCTGAAAATGAAATGCCAGTTAGTAGCCTTGAGATCCAA
GGATCAACAAACAATTCGCTAATCGATACCTCACGGATAGGGTTTGATGC
AAACTCGCGCTAAGTATGCTCAAGATCAACCTTTGGCCGGTGCCCGCATT
GCTGGATGTCTTCACATGACCATCCAAACTGCCGTACTTATCGAGACACT
CACCTCCCTTGGCGCCGAAGTCACCTGGTCCTCGTGCAATATTTTCTCTA
CTCAAGACCATGCTGCGGCTGCTATTGCCGCAACTGGTGTCCCTGTTTTT
GCCT

Sequences in the Contig:

SY0AAC28YN14FM1 SY0AAC35YI14FM1