Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4254
Length(NT) : 776
Best Gene Model Blast : Link to GSTUMT00007055001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: MFS transporter, putative
Accession: ref|XP_001267359.1| Score: 516 E_value: 1e-50
KEGG Definition: fucose permease
Accession: aor:AO090023000920 Score: 512 E_value: 2e-50
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4254
GACCGTACTTTAGGTCTTGTCGTTTGCGATGTCCCTCACGATATGCTTCG
CCACGAGATTCGGTCTCGGCGAACATCGTGAAAGTTCTCTAGATGACCTC
GCGGCCCCGCTTGGCAAGGCTCGGTACGCATACACGCTACTTTATAACCC
TGCTCTCATGGCGACGAAGACGTCAATATTAGTCTTTTACCTTGGGCTTT
CGAAGAATTACAAACTTCTGAGAATCGCTAATTGGGTGACGTTGGTAGCC
GTTAACGTTGCCGGGTTGATTTTGACCTTGCTCATTGCTTTTCAGTGTCA
ACCTGTCTCAGAAACATTTCAAACTTCTCATTCCCCCTCGTTCGAATGCA
TACCGACATATACAATGCTTTATGCTTCTGGTCCTGTCAATCTGATAACA
GATTTGGCGATACTCGTTTTGCCGATGCCGATCTTGACTTCTCTAAGGCT
GCCTAGGAAACAGAAGATCATATTAATCGTGGTATTCGCTGCTGGAGGAT
TCGTTACGGTAATTGGGGATGGTTCGCTCTCCTTCATGTGGAGCTCAATC
GAAGTCAACGTTGGAATATTCTGCGCCTCAATCCCGATGTTAAAGCCGCT
CGTTGCTAGATTATTTCCGAGCTGCATCGGCCTCACAGGTGAAACATCCA
CCACAGCGGGCTTGACCGGCGCTTCCGGAGCCCCCACTGGTCTCAGTGCG
GACGATCGGCCACCAGGATTCTTCGATCTTCCGAGGCCGAAGTCTGCCTT
GGCGCTCAATATGCGAGAATCTATTC

Sequences in the Contig:

SY0AAB27YN21FM1 SY0AAC27YF07FM1 SY0AAC28YN12FM1
SY0AAC6YL15FM1 SY0AAD15YN09FM1 SY0AAD46YJ03FM1