Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4251
Length(NT) : 1080
Best Gene Model Blast : Link to GSTUMT00003244001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: 60S ribosomal protein L7
Accession: ref|XP_001221626.1| Score: 849 E_value: 5e-89
KEGG Definition: 60S ribosomal protein L7; K02937 large subunit ribosomal protein L7e
Accession: mgr:MGG_05237 Score: 830 E_value: 4e-87
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3184 Score: 801 E_value: 4e-86
PFAM Definition: Ribosomal_L30_N, Ribosomal L30 N-terminal domain. This presumed domain is found at the N-terminus of Ribosomal L30 proteins and has been termed RL30NT or NUC018..
Pfam Number: pfam08079 Score: 288 E_value: 1e-26
Swissprot: Q7SBD5|RL7_NEUCR

Sequence:
>Contig4251
TTGGAACCTTGGCCATCAACCACTCCGCCGCCTACGGAAGTCACCACAAT
GCCTAACACTACCGTCCCCACCGCCGACCAAATCCTTATCCCAGAAACTC
TTCTTAAGAAGCGCAAGGCTCAACAGAAGACTGCTGAGGAGCGCGCCGCG
GCTGCTGAGACAAGAAAGAAGGACGTCAAGGCCAAGCGCGAAGTTATCTT
CAAGCGTGCGGAGAAGTACGTAAAGGAATACCGTGAGGCAGAGCGTGAGA
AAATCCGCCTTGCTCGTGAAGCCAAGAGGAACGGCAGCTTTTATGTCCCT
GCTCAACCGAAGCTTGTCTTTGTTGTTCGTATCAAGGGTATCAACAAGAT
CGCCCCCAAGCCTCGCAAGATCCTTCAACTCCTCCGTCTCCTCCAGATCA
ACAACGGTGTCTTCGTTCGCCTTACCAAGGCCACTGCTGAAATGCTCCGT
GTCGTTGAGCCATGGATTGCATACGGTGAACCAAACCTCAAGTCCGTCCG
TGAGTTGATCTACAAGCGTGGCTACGGAAAGATTGATCGCCAGAGAATCC
CCTTGACCGATAACAAGCTTATTGAGGAGAACTTGGGCAAGTATGGAATC
ATCTCCATCGAGGATCTTATCCATGAGATCTACACTGTCGGCCCTAACTT
CAAGCAAGCTTCCAACTTTCTCTGGCCCTTCAAGCTCTCTTCTCCCAACG
GCGGTTTCCGCACTCGCAAATTCAAACATTTTGTCGAGGGCGGTGACTTG
GGTGATCGTGAGCAGTTCATTAACCAGCTCATCCGTAAAATGAACTAGAA
ACTGGAGGTTGTCACAATTTCTTATTTTTCCTATTAGGGGTTCCAAATAA
ACGGTTCTTTTCCTGCCATCTCCACTTGATTTTCCTAGGCCCTCGTTATC
CCTGATTTGAATACTGAATTCAAGCGCTTCCCCTTCCTAGCGCTACCGTA
TTGTGATGCGCCCGGTTGTGCACGGGGTAAAGCGAAACCGTGAAGCTTCC
TGCATTATCATATACGGGTAGTTGTACTAGTTCCGTACTGTAATATCAAA
CCTGCCCCCTTGGCATTATTCGCACTTACG

Sequences in the Contig:

SY0AAA43YL21FM1 SY0AAA54YE16FM1 SY0AAB16YG17FM1
SY0AAB21YH23FM1 SY0AAB33YP03FM1 SY0AAB39YH08FM1
SY0AAB3YH23FM1 SY0AAB42YI24FM1 SY0AAB4YA15FM1
SY0AAB54YH08FM1 SY0AAC20YD08FM1 SY0AAC20YD08RM1
SY0AAC28YM03FM1 SY0AAC52YF05FM1 SY0AAD18YH05FM1
SY0AAD36YC14FM1 SY0AAD3YC10FM1 SY0AAD55YB10FM1