Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4250
Length(NT) : 634
Best Gene Model Blast : Link to GSTUMT00009948001 E-value : 1e-128
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_06794
Accession: ref|XP_001242898.1| Score: 366 E_value: 8e-53
KEGG Definition: AMP-binding enzyme, putative [EC:6.2.1.3]; K01897 long-chain fatty-acid-CoA ligase
Accession: afm:AFUA_5G08470 Score: 363 E_value: 5e-51
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1177 Score: 208 E_value: 1e-17
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 123 E_value: 9e-08
Swissprot: Q0P4F7|ACSF2_DANRE

Sequence:
>Contig4250
TTGGGGAGAGGGAAAGGCACATCTGACTGAGGAGGGGATGGGGGTTGACG
ACGTTGTTAATATCCAGTTTACTAGTGGGTGAGTTGTGGTATATATGGGG
GATGGAAAGGGGGATGTGGAGGCTGATGAGGGGAGAGTATGGTAGGACGA
CGAGTTTGCCGAAAGCCGCGTGCTTGACTCATCGTTCTATACTGAATAAT
GGGAAGAGCATTGGTGATAGAATGCTCCTGACGAATAAGGATGTTATATG
CTGTCCTCCACCGTTATTCCAGTATTCCTTACTCCTCCATCCACCCCTTC
CCACGCTCGCTGCTGACGAAGGGCCAGCTGCTTTGGTAGCGTTCTAGGCT
ACATGGCCTCTGCGACACACGCCTCCTGCATCGTATTCCCTGCCGAATGC
TTCGACGCGAAGGCAACCCTTCATGCCGTGCAACAGGAAAAGTGCACAGC
ACTGTATGGTGTGCCGACAATGTTCACGGCGGAGCTAGAGCTGTTGGCCA
GCGGGGAGGTGGAACAGAAAGGTTTCGAGCATATCAGAACTGGGATTGCG
GCTGGGAGTAATGTTCCGAGGGAATTGATGAAGAAGTTGCATAAGAGGCT
GAATCTGACAGCTGACTATATGCTATGGAATGAC

Sequences in the Contig:

SY0AAC28YL19FM1 SY0AAC37YH15FM1