Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4249
Length(NT) : 680
Best Gene Model Blast : Link to GSTUMT00000078001 E-value : 9e-86
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4249
GAAGTGGTGGAGTGGAGTGTTGTATGGTGTATGGTGTATAGTGTATGTAA
GTGTATGGTTGTTTGTTTGTAGGAAGGAGGAGGAGGGGGCGGAGTTATCG
TGCCTTATATTGTCTTGCAGTACGCATCATTTGTGACGAGCGTTGCATGG
CTCGTTGCGGGGGGGATGGTCTTTCTTGCTTCTGGCTTTTGTTTTGTTGA
TGTGAAGATATTCTTGTTTTGCGGATCATTTCTGATCTGTTTTGGCTCAA
GACCGGTTGCTCATGGTTGCTACTCCCTGGCGCTACGCCATGATGAAACC
GTGCAGGGTCCACTTCCTTATCCGGACATGATACTCAGGACAAAGGAGGC
TAGGCTGTATTTGATTTTTATTGGCAATTTTTCTAATCTACAGGTGGAGC
TGGTTTCGCGAGACGCCCGGTACTTGGAGAAGATACCAGTATGTGGACAG
AGGAAGGGAGAGATAAAGTAGGCGACGTGGAGCCTGTCTGAAGGGGGAGA
GAGAGTATGGTGCTAAATTTTACTTGGGGATGGGACTACAGTACCGGTAG
TCTCCGGCACCAATGGTCCGCGCGCTTGAATGTATGGCTTGGTGATCATT
CTGCTGGGGGGTAGACCCCGACTCAGGGTCTTCTTCCTCAAAGAGAACTA
GTGCTACACCGGCTTTTACTACGTCCCCAA

Sequences in the Contig:

SY0AAC25YI04RM1 SY0AAC28YL18RM1 SY0AAC47YJ18FM1