Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4248
Length(NT) : 1019
Best Gene Model Blast : Link to GSTUMT00007200001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein SNOG_11381
Accession: ref|XP_001801624.1| Score: 323 E_value: 4e-28
KEGG Definition: hypothetical protein
Accession: fgr:FG00698.1 Score: 308 E_value: 1e-26
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG4207 Score: 126 E_value: 8e-08
PFAM Definition: No Hit Found
Swissprot: O74497|YCRA_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig4248
AATAAAATAGCGGTGATGATGGTGTGGGAGGAGAATGAAGAAGGGGAAAG
GGGGGGTATATATATTAGGAGGGGGTAAGTTCCCGTTCCCTTTTGCTGTG
TGAACAAGCTTTTTTCCTTTCTTCCAAACGGGTTTTTTCAAAAAGAAAGA
AGAGAAGAGAAGAGAAGAGATGTGTTTTGGCCACAGTAATAAAAAGTCCA
ACAACTCTTTCCCCCCAACTCCAACTTCCCGAGTACATCAACCGCCCAAG
CGCACTCCCGAACAACTGGCCAAAACTCCCGATCCGCCAGTGCCACCCTA
CACCGAACACCCCTCAAGCATGGCTGACCCGCCACCACCGTTCACCCCCT
CCGCCTCGGCAGCGGACCTGCCGCCGGCGCCACCGGCAATCCGGCACGAC
GTGAGCCCGACCTCGAACGCCCCGCTCGCCCTCGCGGAGTCCGGCTTCAC
CTTCTGCGACGAGAACCCGCTCGTGCCGCCGCAGCACCTGACAGCCGCGT
CGCTGGAGGAGATCTCCAGGGGTGCACTAACGCTCGTCGTCCCCCCTTAC
AAGGCTTACTTAAACCACGTGACGGTGGCCAGCTCGCCGGAAAATGGCCT
GCCGATCGTGTCCACCTCCTCCAACTGCCCGGACACCGCCCTCCTGTCCT
CGCTGCCGCTGTACGCCGCTGGCTTCCACCACCCGGCCAACACGGGTTCG
CCCAAGCACATATACTTCGAGGTCCGCTTGCTTCGCCTCCCACGCCGGGC
CGATAAGGGCGCTGTGGCCATCGGCTTTGCCGCGAAGCCGTACCCGCCCT
TCCGCTTGCCGGGATGGAACAGGGGGAGTCTGGCCGTGCACGGGGATGAC
GGACACAGGTATTGTAATAATGCGTTTGGCGGGAGCGAGTTCATGGAGGC
GCCGTGGAGAGTTGGGGAGACGGTGGGCATTGGTATGACTTTTGGCACTG
GGAGAGTAGGGGGAGGAGGGGGGGAGGTTTGGGTTGAGAGGAACGGGAAG
AGGGTTGGTGGGTGGGAGA

Sequences in the Contig:

SY0AAA19YD04FM1 SY0AAA22YD01FM1 SY0AAA39YF05FM1
SY0AAA41YP16FM1 SY0AAA8YH23FM1 SY0AAB38YC03FM1
SY0AAB46YK02FM1 SY0AAB7YP06FM1 SY0AAB8YE10FM1
SY0AAC28YL17RM1