Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4247
Length(NT) : 670
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: related to N-acetylglucosaminyl-phosphatidylinositol biosynthetic protein gpi1
Accession: emb|CAF05894.1| Score: 425 E_value: 3e-40
KEGG Definition: hypothetical protein
Accession: fgr:FG06057.1 Score: 396 E_value: 3e-37
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4247
TTGGCCTCATCTTTCCCGATGAAGTTATTGCGGTATACGTCTCTGTGAAC
CATCCTCAAACCTTGCGCCAGCAATTCTCAGAACAATCCCCGGCTTTCGA
CACAACTTGCCCCCCACCACCTCCTCGAAATACTCCTCCGGGCAATTCCC
GCCAAAGAACCTCGAATCAACAAAACGGATTACCCCAATGGTAATGCTGT
GATAGCAAGAGATTCATGCACCCCTTCTCCATCACTTTTGCGATCTTCGT
AGCCGGCTACATCACTGCGAGGTGGGATCTTGTTACTCGACTTTATGAAC
TTGCCATCTTTGCCTGGGACCACGGAGTTGTTACACGCACGGCCAAGGGA
TTTGCGATTCTTTCAGTCTTCTTCTTTCTATTCATCATTCCCGTGGAGAG
ACTTGCATCCCGAGAAACAGACCTGCATCCACGATCTGGGAAATCAGGGA
TATCAGCGCGAGAACAACTACGGCGACGAGGATCCTTCTAGGGAAGGATT
TGGAGCGAAGACTTGGTCATGCCCGCCGAGCAAGATGGACTTATGAGAGT
ATTTTGGCCGCTGGATATACCGAGATCAGATCACCCAGGGATAATAGTTG
GATGGAGAAACTCAGGACTTGATTTATTCGTGGTGGCCATATTGGAGGAT
GTTGACGTGAGTTGGAATTG

Sequences in the Contig:

SY0AAC28YL16FM1 SY0AAC36YD08FM1