Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4246
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00002945001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein MGG_01492
Accession: ref|XP_363566.1| Score: 132 E_value: 3e-06
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01492 Score: 132 E_value: 1e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4246
TTGGGAGTGCTTCAATACCTTCTGCTCGTCTTCTACTTGGGTTTCGGATC
AACGAAATTTTAGTGCTTTTGGAACATCCCTAATGAGTTCCCCGATGCTT
TATGAATCACCTTCGGGGCACGTTGTCCTTCTGGATATACCCTCCTCCAT
CTCGAGTCCCCCAGGACTACGGCTCTGCTCTAGCTCGCCTCCGGAAACTC
CGTACGTTCTCCCAGAGCCCAAAGGTAATCCCGTAAGCCAGAGCTCCATA
GAAAGTACAGACGAGATCCGAACCCTGGTATTAGAGGCCCTTGAGCATGT
TGGCAAAAATTACAGTGGACCATTTCTTCTCCCCAGAATAACATTAGAAG
CTGGGGCCCAGATAACCGGAGAATTAGACTTCCATGAGAATGTATTACTG
CTTCAGAATCCAGACTCCTCATCCTCCCCGGAGTTTCTGGACCTTGCCCC
CGAGCAAGAGCCAGCGATTGAAGAAGTTGACGACATCTCAGACATGTACT
CGACGCCAGTATTCTCAACGTCTAGAGCCTGGCGAACTCTAGCCATCCTC
CACCCGGCTCCCCAGAAGTACTTCTACATCCCCCCGAGCTCCTCTTTCCT
CCTCTCAGACTTCCGAACATCCATCCCGGCATTCACTGCC

Sequences in the Contig:

SY0AAC28YL04FM1 SY0AAC35YA04FM1 SY0AAC44YI10FM1