Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4244
Length(NT) : 666
Best Gene Model Blast : Link to GSTUMT00010457001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein CHGG_06730
Accession: ref|XP_001222825.1| Score: 236 E_value: 2e-18
KEGG Definition: adhesin, putative
Accession: afm:AFUA_2G10130 Score: 191 E_value: 2e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4244
TGTACAAAAAGTTGGCCAACTTTTTTGTACAAAGTTGTCCCCACAACTCG
ACCCAAGCCGCCTTCCGCATTCACTTTCGAGAACCAATTCAACCAACTTT
ATAACCACTCGCTCGCTATAAAAACAAAATGAAGTCCATACTCGCCGTCG
TCTTTACCCTCCTCAGCTTTTTCCTCTTGACCTCCGCCGTCCCCGCTCAC
GGCCCGTCATGTGAGCAGTGCGATCCTATCCCGCCCAACAATCGCTGCGA
TATCACCACTTCTTGCATTCGCACCGAACCCAATGGGCAATACCATTGTG
CATGCCGTGCCGGATATCAAGCCGATGCTCCCGTTACTGATTCCACCACG
CAATGGCGCACTAAGTTTATCGGGCAGGAGTACAGGGTTTTCGTCAAGCC
CGGTGTCGTGTGCAATACTCTCTGCGCCGACTCCGCCCAGGGTGCCAACT
CTTGCCAGGCAATTACTATTAGGCCTGAGTGCTCTTAAGTTTGTGCTTCA
ATTGCTTTAGGGGGTGTAGGATCGGGATTCTTGGACTTGGAAATGGATTG
CGGGAGACCGGGCGTTTTGGCCTCTCCCAACAATAGCTGAGAACGGGAGT
TTTTGGAACGTGGTGCATTTCCCAAGCTTGGACAATTTAGCGGTGGTTTG
GGTTCGGAACCGTTAG

Sequences in the Contig:

SY0AAB36YI12FM1 SY0AAB52YA11FM1 SY0AAC28YJ16FM1
SY0AAD50YE02FM1 SY0AAD52YO05FM1 SY0AAD58YG24FM1