Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4243
Length(NT) : 1268
Best Gene Model Blast : Link to GSTUMT00000968001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein MGG_00587
Accession: ref|XP_368657.2| Score: 145 E_value: 3e-07
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00587 Score: 145 E_value: 1e-07
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 117 E_value: 1e-06
PFAM Definition: No Hit Found

Sequence:
>Contig4243
TTGGCCCCCTTGTGCCCCCCCCAAATAAAAAGCGGAGCTGCCCCACAACC
ACAACATCTAATCAAAAAATCAATACACGCTCCCAACCCAGGGAAAAATA
ATAATAATATAATACAACCTGCCCCCCCCCTCCCAGCTTGTCGATAGCGA
GGGGTAAAAAGTTACATACATAATATCTCAAAAGTTGAGAATTGTGTTCT
CTCGGTCGGCCTCTATCATCCCGTCACGCTCCAATTTTTTATATACGGTA
CTCCTATTGCAAAATGTCGATCCGATTTGGACGAAGTGGAAATGGGTACG
ATAGCTCCGAAGTCATGGAGACTGAGGATGATGATTGGCGCAAGGTGACA
GACTTGAACGAGCGTCGCAAGATTCAAAATCGCTTGGCTCAGAGAAACTA
CCGTCGAAAACTGCGTCAACGTCTGGAAGAACTTGAGAGACAGGCTGGAA
AGAATAGTGGCCCATCCACCTCAGTATCCAACAAGAAGAGACCGAAGCAG
CCAACTTCTGGAGCTGGCACTGTCAGTGAAACATCTGCTAGGGGTCGCGC
CAATTCTGGACCGAGACGTGGGGAATCTTCCCATGCTCCTCACGGAGTGG
TGGACACAGAGGGCCGCTTCTCGACAATCGATTCCCTCCTCTCACCTCCA
AGTGTGTCTGGTGAGTCTGAGGACAGTAGCGCTTCCGCCTCCTCTCGTGG
AATCTACACCAGTGATTTTAGCCCCATGCTGCTACGACCAACGGCCAGGT
CCTCAGAAAACACATATCCAGTATGGCAAAACCAATCACAGCTTCAGTAC
CCCGAACCTCCAAGTTACAGCTCGAGCCAGCCATACATTGCAAGCACTTC
TGAGTACCCTCCTACCAGCAGTGTCCCTGCTCCTTCAGTGTCTCCAGCGC
CAACTCATCAGCAGCTACAAGCATTCGAATACGAACAGTACCTATCGACC
CAATGTCCGCCAAACTACCAATATTGAAATGCCAGACCAAGCGGAATTCC
CAACCTTATCTCCTACCTATTCGTCTAACCCAACCATCGACCCAAACACC
TTGCACTTGAACCCACTAATGCCTCAAGACGAGTTCTATCTGGCTCTCAA
CTGCCCCAAGCTCTTAAATGCGGCAGTAACGATTGGCAAGATCCTGAACG
TTAGTAGGTTAGAAATGTTTCAGGATGACACACCATCACTATTCGTTCGA
GAGAACACAGAAGAACCGCTGCTCAAACTACCAGATAATTCTCCTGATCT
CCAGCCGCCAAAGGTTCG

Sequences in the Contig:

SY0AAA18YH11FM1 SY0AAA61YP24FM1 SY0AAC28YJ09FM1
SY0AAC35YO18FM1 SY0AAC6YG24FM1 SY0AAC7YI11FM1
SY0AAD35YA02FM1 SY0AAD48YN17FM1 SY0AAD49YG14FM1
SY0AAD5YF24FM1