Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4242
Length(NT) : 888
Best Gene Model Blast : Link to GSTUMT00011244001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_03504
Accession: ref|XP_001557922.1| Score: 722 E_value: 2e-74
KEGG Definition: potassium ion channel Yvc1, putative
Accession: afm:AFUA_3G13490 Score: 646 E_value: 6e-66
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q12324|YVC1_YEAST
Gene Ontology:
GO:0000324 = Cellular component: vacuole, cell cycle-correlated morphology
GO:0005227 = Molecular function: calcium activated cation channel activity
GO:0005262 = Molecular function: calcium channel activity
GO:0005267 = Molecular function: potassium channel activity
GO:0005272 = Molecular function: sodium channel activity
GO:0005244 = Molecular function: voltage-gated ion channel activity
GO:0030003 = Biological process: cellular cation homeostasis

Sequence:
>Contig4242
TTGGCTTTCACTCGTCCTGCGATACTCCTACTCAATTTTGCTTTCTTCCC
TCCTCTCCCTCCTCTCCCTTCTCCCCCTTCTCATATCCCCCCCCCTTCTT
CCTTGCTCACCATCTGTTGTTTCTTTCACCAAAAGTCCAATTGCTCCCGG
ATTGGGCCATCATGGTGAATTTCCGTTCATTGCTGGGCACCGGTAATGGT
GCTGGGCGGGGTGCCACTGAGGATTTGAGGGAGCATTTATTGCCTACGCA
TCGGGGGGACCATTTTCACGCATTGGTACCGGCAAAAAGGGTTACCAAAG
CTGCATTGAGACTTAAATTCCTCATCGAAGCCGCGGTTCCTTGTGAACTA
AAAGAAACGCACATCACGCGCCCTCACTCGCAGATCATAACCAAGCAAGT
GGTTCTTCTTGCTCAGGAGGCTGCTGGCGATGAGGACAGAGCATGTATTG
TTTACTGTCTCCTTGTCTGTCTCCGCTGGTTCAAGCGACAAGCTCGGTTG
GAGATGTACGATGCGGGCTTGTACTTGCTGAGAGCCGAGGCTTGTCAGGT
CATTGCCAAGCGTATTATCGAGGACATTTCGGAGAATGAGTACTTGTTCC
AGGAGGTGCTGCTTAAGAGGTACAGCATTTTGAGAAACGGGCAGGAGAGT
ACGCCTGCTAACGCTGTTGAGCGAGCGGTGGACCTCCATGCTACGAGAGT
GATTGGGTCTTCAGGTTACCAGAAGTGCATCAACTATCTTTGGAGAGGTT
GGGTTGCCCAGGATCTAAACGATCCAACTCAATTCTGTGCCTACAAAAAC
ATTGCTGAAAGGGGTTTTTGGATCCATTTCGACCATGACCGTCTCCGAAC
TCCTAAATACCAAAATGCCTTTCAAGTGCTCATCTCGG

Sequences in the Contig:

SY0AAA32YA08FM1 SY0AAA54YB05FM1 SY0AAC28YJ08FM1