Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4241
Length(NT) : 1836
Best Gene Model Blast : Link to GSTUMT00010488001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SNOG_05249
Accession: ref|XP_001795657.1| Score: 1497 E_value: 1e-164
KEGG Definition: nuclear exosomal RNA helicase MTR4, DEAD-box superfamily [EC:3.6.1.-]; K01529
Accession: aor:AO090023000859 Score: 1474 E_value: 1e-161
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0948 Score: 1584 E_value: 1e-176
PFAM Definition: DSHCT, DSHCT (NUC185) domain. This C terminal domain is found in DOB1/SK12/helY-like DEAD box helicases..
Pfam Number: pfam08148 Score: 672 E_value: 6e-71
Swissprot: O14232|YDVG_SCHPO
Gene Ontology:
GO:0031499 = Cellular component: TRAMP complex

Sequence:
>Contig4241
TTGGGATAGGCTTAATTCTGCATTCTACTTGGGTTACAACATGATTCTCA
ATCTCATGAGAGTTGAAGGAATATCGCCCGAATACATGCTGGAAAAGTGT
TTCTTCCAGTTCCAAAATCATGCGGGTGCTGCAGGGCTTGAAAAGGAATT
GAGCGAGCTTGAGACTGAGAAAATAAATACGGTTATCGAGGATGAGCCGA
CCGTCCGAGAGTACCATGACCTACGGCAAAAACTTGACGGCTACACCAAA
GAAATGCGCGAAGTAATTAACCACCCCAATTACTGTCTACAGTTTATGCA
ACCTGGGAGACTTGTAAAAGTGAAGTATCTCAATTATGATTTTGGATGGG
GCGCCGTCGTCAACTACACCAAGAGACTTCGTTCAAGGAGTGGAGAGGAG
TTTTCGCCCCAGGAATCTTATATCGTCGATGTCCTTCTAAACATCGCCTC
TGACACGTCGTCTTTTACTCGACCTGGTCAGGAACTCCCCACAGGAGTGA
GGCCCCCTAGCGAAGGCGATAACGGCAAGATGGAAGTTGTACCTATCTTA
CTTTCCTGTTTAGCTAGTATCTCAGGCCTCCGTATTTTCCTCCCCAAGGA
TATGAAATCACAGGAGCAGAGAAATAGTGCCAGAAAAAATCTCGATGAAG
TAAAAAGACGATTCGCAGATGGTATCTCAGTCCTTGACCCTATTGAAAAT
ATGGGTATAATCGACGATTCGTTCAAGAATCTTCTTCGTAAAATCGAGGT
TCTTGAATCGCGTTTGCTCTCCAACCCTCTCCATAACTCCCCTAGATTGA
AGGTCCTATATAACCTTTACAATCACAAAGTTGAATTGCAAGAGAAGATT
AAGGCAGTAAGGAAACGGATAAATCTTGCGCATTCAGTGATGCAACTGGA
AGAACTCAAGTACCGTAAGCGCCTGCTTAGGCGGCTCGGGTTTATTGATG
AATTAGACACTATTCAGCTGAAAGCCCGTGTTGCATGTGAGATTAGCTCT
GGTGATGAACTTCTCATCAGTGAGCTCCTTTTTAACCGGGTCTTCAATGA
GCTCTCACCCGAACAAACCGCTGCGCTCCTCTCTTGTTTCGTGTTTGAAG
AAAAGTCCAACACTGAAGCCAAGCTAAAACCTGAGCTCGAGAAGCCGTAT
AAGGAGCTTCTAAGCCAGGCAAAGCTTATAGCAAAGATTTCTATCGAAAG
CAAGCTCCCTGTTGTTGAAGAAGAATATTGCCAAAAGTTTAAAAACCAAC
TTATGGAAGTCGTCTATACTTGGAGTCAAGGCGCATCCTTTGCAACTATC
TGTAAGATGACCGATGTATATGAGGGAAGCCTGATTCGGATGTTCAGACG
TCTCGAAGAACTCTTGAGACAGATGATCATGGCTGCCAAAGCCATGGGCA
GTCCAGAGTTGGAGAAAAAGTTCGAGGACGCGATGGGTAAGGTTAGAAGA
GACATCGTCAATTCTGGTTCGCTCTACCTTTAAACCACGCGGCCCCACTC
AACTCCAGTGGCCTGACATATGCAAGACTTGTCTTTCCTTCTCTTTCGTT
CTTTTTTCACTTCATCCTCTCCTCAGAAACCGGTCCGTGCTTGTTCTCTT
TCATTTCCTCGCCTCCCCTCCTGCAGTTCGCCTGATTCTTTAATGTTTGA
CGTAGAGTACTCCCTTCCTTTTAGATGGATTGACTACAATGACGTAATTA
CGTAAAAGGCAATTGAACTTTCTTATTTTTTGTTGAGGCAGTAGATGAGA
CGGAATGGACATGGTGCTACTACTGTAAATAATGCTTTTCTTATCTCTTA
TTTAACTAATCTTATGGGAAATGGGATGGGGTTATC

Sequences in the Contig:

SY0AAC14YI04FM1 SY0AAC26YP09FM1 SY0AAC28YI11FM1
SY0AAC34YF09FM1 SY0AAC3YM22FM1 SY0AAC48YG13FM1
SY0AAC56YB14FM1 SY0AAD10YJ22FM1 SY0AAD30YB20FM1