Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4240
Length(NT) : 1325
Best Gene Model Blast : Link to GSTUMT00003155001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SS1G_13876
Accession: ref|XP_001585307.1| Score: 614 E_value: 1e-61
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01489 Score: 524 E_value: 2e-51
KOG Definition: No Hit Found
PFAM Definition: Hamartin, Hamartin protein. This family includes the hamartin protein which is thought to function as a tumour suppressor. The hamartin protein interacts with the tuberin protein pfam03542. Tuberous sclerosis complex (TSC) is an autosomal dominant disorder and is characterised by the presence of hamartomas in many organs, such as brain, skin, heart, lung, and kidney. It is caused by mutation either TSC1 or TSC2 tumour suppressor gene. TSC1 encodes a protein, hamartin, containing two coiled-coil regions, which have been shown to mediate binding to tuberin. The TSC2 gene codes for tuberin pfam03542. These two proteins function within the same pathway(s) regulating cell cycle, cell growth, adhesion, and vesicular trafficking..
Pfam Number: pfam04388 Score: 224 E_value: 5e-19
Swissprot: Q09778|TSC1_SCHPO
Gene Ontology:
GO:0033596 = Cellular component: TSC1-TSC2 complex
GO:0005515 = Molecular function: protein binding
GO:0006995 = Biological process: cellular response to nitrogen starvation
GO:0006886 = Biological process: intracellular protein transport
GO:0043091 = Biological process: L-arginine import
GO:0009935 = Biological process: nutrient import
GO:0031929 = Biological process: TOR signaling pathway

Sequence:
>Contig4240
TTGGTAAGGGCGGAAGTTGGGGTAGCCCTTGGCAGAAATTGGACTCTTCC
TTCGAGACTGCAACTTCGACAACCCCAGATGTGAGCGATTACTTCACTTT
CCTCTATGGATTATATCCCCTCAATCTTATGGCGTTCATCCGGGAGCCCT
ATAAGTTTCTGGAGCGAGCAAACTACAAGGACATCGACCACTTAGATATC
GACGAAGAGACAATAAGGCAGCGAACAGAAACATACCGCCAACGGCACAC
ACTTCATCCGAATTTCCTGAACCTGACAGCTGAGACAGAACTAACCGACC
AAAGCCGCTGGATGAAGGTGGAACCAGCGGACGTGACGGCGGAGTGTATC
GGTCTTGTTAATAGTAGTATCCCAATGGGCTCTGCACACGACCCAAGGGC
TAAAGGGGCTGTTCCAGCTGCTCCTGCAAAGCCAGAACTCCCCGAGGCAC
TGGTACCTACAGAGGATATTCCTAATGAAAGCCTATTGTCTTCTGAAGCC
GTAGATGATGACCATGCATCCAATTCCGGCGCCTCTGCGCAAAGCTGGAG
GGGCGATACCCCTGCAATATACCCAAATAATAATTGCACTGAGGTCCTTG
GCCTCTTCTCACGCCCTCCCGTAGGATATGGGGCCCACTCGCGGGATTCC
CCGTATACAATACCTCGGGATTCCAAGACACCCGATAGTCCGACAATACC
GCACACGATAGCACCATGTGAGGAAGAAGAGCGGCTCCAAGACATGATCC
GGCTCCAAGAGAATTTGCGTGCAAACTTGCATGAGTCTATGAAAAACGAT
TCAACGCATTCGCTACCACCGCTTCCTGGACCACCTCCTTCCGGCCCACC
TCCAGGATATGGAAGTGTTACGGCTTCACCCCGGCTCGACGCTTACGTTC
ACTCACTCAGCCAAAATACAGTACCGCGGTCACCAGCGCTTCGGCCGGCC
GCGTCCGATACCCAGGGGACTATCGCATTCCTACAAAGGGAGGTGATGTT
GCTCAAGAATGACTTAAATTTCGAGCGTTATCTCAAACAGCAACATCTTT
CCCATATTGGCCATTTACAGAGAAAGCATATTAAGGAGGCCACTGCGGAA
GCAGAGACACAGAATTTGATTAACACTAATAAGACATTGAAGGCTAAATT
AGAAGAGGCGAAAAAGGCCTATACAGCTTCGAGGCAGGGGGCTTTGAAGA
GTAAATCCCAAGCTAAAAAATGGGAAGCTGAGCTCAATTTCAAGATACGA
AGCTTGCGAGAAGAGCAAATGGCGTGGAGAAGTGATGAGGAGTCAACAAA
ACAAGCTCTCCAGGCGGCCAGAGAG

Sequences in the Contig:

SY0AAC22YM24FM1 SY0AAC28YI03FM1 SY0AAC62YE09FM1
SY0AAD33YE17FM1 SY0AAD39YH14FM1