Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig424
Length(NT) : 843
Best Gene Model Blast : Link to GSTUMT00008720001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SS1G_02888
Accession: ref|XP_001596666.1| Score: 247 E_value: 4e-37
KEGG Definition: calcium binding modulator protein (Alg2), putative
Accession: afm:AFUA_3G08540 Score: 192 E_value: 5e-29
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0037 Score: 235 E_value: 1e-20
PFAM Definition: No Hit Found
Swissprot: Q8BFY6|PEF1_MOUSE

Sequence:
>Contig424
TTGGATACCACTTACATCGCCTATCCAACTTTCTCCCGCAAGTTCTCCCT
TGTTCGTCCTACTAGGGAGGTTAATTCCCGAGCTCGATCAGCCCCGGACC
CCGCTAACCCGCGAAGATATATTCCGGCGCCAAAAAAATGGCCTACTATA
ATTCGAATCCTGATGCTCTCCCAGCCCACGCAGAACCGGAGCAAGCCGCC
CAGATGATGAGCGGCGGATACGAAAACCGTCCCCCTCCGAATCGCCCACC
TCCAGTGGGATCAAACTACGGAGGTGGCGGTGTGAAGCCAATGTCCCCCC
GCCCGGACCCGTACCGCCAGCAGCAAGGACACCAGGGGTATAACCAGCCA
CCGCCCGGGCGACCCCAGCAGTTCCAATCCCCACCTCCGGGGCAATTCGG
TGGCGCTGGACAGCGGCCTCCACCGGTTTCAAGACCTCCGCCCACGCCTG
CCCCAGCCCAGGGGGTCGATCCGACGTTGTTCCCGCTATTTAAGGCTGTG
GACAAGGATGGCAGTGGACAACTGAGTGAGAAGGAGCTTCGAGCTGCACT
CGTCAATGGGGATTGGACTTCCTTTGATCCTCACACTGTTCGTATGATGA
TTAGAATGTTTGACACTGACCGTTCCGGCACAATCGGCTTCAATGAATTC
TGGTCCATTTCCATCTCTCCCCCAACTCGTAGAAGCTACTAACACCCCAT
ACAGCGGTCTCTGGGGCTTCTTGGCCGCCTGGCGCTCCCTGTTCGACCGC
TTCGACGAAGATGGCAGCGGTAACATTAGCATCCAAGAATTCTCCAACGC
TCTAACCGCATTCGGCTACCGTCTTTCACCCCAGTTCGTGCAA

Sequences in the Contig:

SY0AAA23YL02FM1 SY0AAA28YJ06FM1 SY0AAB26YP06FM1
SY0AAB30YC24FM1 SY0AAB40YF07FM1 SY0AAC45YH22FM1
SY0AAD30YE11FM1 SY0AAD44YJ03FM1