Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4239
Length(NT) : 990
Best Gene Model Blast : Link to GSTUMT00011546001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4239
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCGGGGTAAACGGTGACGGA
GCACATACGAATCGAAACAAAAGTATCTTCCTATCTTTCTACTGGTCGCC
ACACATATCCGCTCTCGTCCGCGCAGGTCTCCCTTTCCCCTACGTACTCC
CATGCCTACTAGTGAAAAACAGATCGTTGTAGCCAGTATAATATAATAAG
GTTAACCATGCTAACAAAAGAAAGATAAGTTAGGCTTCATAAAGACCCCC
ACTATTCACTGACTCCGCTCCATTCCTTTAACCCCCGTACCGCTTCCGAC
GGCGCATTATCTTCTTCCGACGGCCATCATTTCCTCCTATGGATGCGTTA
ATCCAAAGCGCATCTCCAAACATTTATCCGAATAAATGAAACAACATCCT
AAGCATCCGAGCATGCCGAGCAGCGTCTACGGTTCCAGAACGGTTCCCCT
TGGCTTAAGTGGAAGCGCGCAAAGATGTCGTGAGCTATTGCGGGGCAGAA
AGTCGTCGAGCGTTCCCAGAGGTGTCATGGATCATTACGAAGCAGACGGT
AGTGGAATGTTCTCTGCGTTCAAGGACTACCCCTACTTTGCAGAACCATC
AAGGTTGAGCACCGGGCACAAATCCAGCAGGACAGTGAACCAGAGAAATA
AGATGCCGGCGCGCAAGCCACAGTCAAGGCCCCTCTACTTACGATTGACT
TTGATTCTCACTCTTCAATACTTCCTACCCTTCCATTCCCTCCTCGAAAT
CATAATCCGCTTCGTGTGACCTCTTTTTTTCTCTATCTGAAGATTCGTGG
TCGCGATAATTGGACGGCAATACAGTCTTCACCGGGAGCGTGGCAAAACT
GGGCGGATTGAGGTGTTCACTTTTTTCCCATGCAGTGCTTCTGTTCGCCA
CCCGCTTAGTTTCGTCATGCCCCTACCGGTAGTACAAACCCTTTCATATC
ATTCTCAAAAACCACTACCAGTATGATATAAGCTGCTTTC

Sequences in the Contig:

SY0AAA41YD21FM1 SY0AAB31YD03FM1 SY0AAC28YH23FM1
SY0AAC2YB22FM1 SY0AAC52YC12FM1 SY0AAC8YL20FM1
SY0AAD38YG17FM1