Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4238
Length(NT) : 2497
Best Gene Model Blast : Link to GSTUMT00007664001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein CIMG_09017
Accession: ref|XP_001239396.1| Score: 1503 E_value: 1e-164
KEGG Definition: hypothetical protein
Accession: ani:AN1093.2 Score: 1500 E_value: 1e-164
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0044 Score: 597 E_value: 5e-62
PFAM Definition: No Hit Found
Swissprot: P87320|MSP1_SCHPO
Gene Ontology:
GO:0005758 = Cellular component: mitochondrial intermembrane space
GO:0005774 = Cellular component: vacuolar membrane
GO:0003924 = Molecular function: GTPase activity
GO:0005515 = Molecular function: protein binding
GO:0008053 = Biological process: mitochondrial fusion
GO:0000002 = Biological process: mitochondrial genome maintenance

Sequence:
>Contig4238
GGTGCAACTTTCTCACTCATGAATTGGAACGTAACAGTGGGGGATAAAGA
AGAACTTGGCCCCGGAAATGGCTAGTTGGGCAATTAACAAGACCGGATGG
CTACATTGAACTCTTTTCCCCTCACAAACAAAACCGGGTGAAAGCAATGA
GAAGACAATTCCAACACGGACTCCGTTCTTTGAACTTCCATGGACTTGAA
AAGACAGAGAAATGAAAGGAGAAGAAGAAGCCAAGAGAAACCCGTGCTCG
TCGAACTTTACACTAACTTGAAACAAGCAGTGACATGTATTCGGCAGTCC
CCCTCTGAACTACCGGTAGACTGAAACCCATCATGTAACCATATAAAGGT
TTCGAGGCATGACTAGATACTAGTTATTCGAACTTTAGGTTAGGGGGAGG
TAAGAGGAATGCGAACGCGAGATATCACGATTTTGATGTCGCAGGAAGCG
CTTGTGGACGAGCAAAGAAATGTAAAAGAAAAAAAAATAGGAACAGTGAA
GAGAGACAGGTAGGAAAAAAGAGAAAGAAAAAGTAGAAAATAACGCCAGG
CATTAGACGAGCCCATCGTAGAGGGATAGGGCAGAGACGATGGTTGCGTC
CTTTTGGCTTCCTTCACGGAATTCAGCCAAGGTCAAGCTTCCGTTCTCGT
CCTTATCCATCATTTTAAAGATCTTTGTAACCCGCTTCTGGGGTGTGTCC
TCGTCCTCAGGAAGTTTTACCATGGATCCGACCATTTTGTAGATAGCCTC
CACAATCATCAACATCTCATCGTAACTAATCTCTCCATCACCATCAATAT
CGTAGAGTTGAAACGCCCAATTGAGCTTGTCCTCTAAGGATCCGCGTGAG
GTGACGCTCAAAGCGACGATAAACTCCTTGAAATCAATTTGACCGGAATT
ATCCGCGTCGAACACCTTGAAGACATAGTCTGCGAAAGTGGTGGGGTCGC
CAAACGGAAAAAACTGCTTGTATATTTTCTGAAATTCGACCTTTCCAAGA
GACCCAGAAGGACAGTCCTTGAGGAAACCTTTGTACCATTGCTGAAGTTC
CTTGCGTTCGAAAAGCGTAGCCTTCCCAACTTTTTTGTACAAAGTTGTCC
CCCCAACTTTTTTGTACAAAGTTGTCCCCCCCGGCCGCCGAGCACCAAGT
TCTCATTCGGTCGAAATGTCAACATCACAAATGCCATCAGCAAGAACGAG
AACACCTTTTTTGGAGCACATCCGGAGTTTGCGGCACCGGATAGCGGTGT
TACTGTTGGCACAACAAATTTGAGAAAGAAGCTTATGTCTGTCCTAGAGC
AAACGATGGCCCAGAGTCTTCAGGGCACTAGCGATGCTATTCATCAGGAA
CTAGAGGAAGCTACCTATGAATTCAAGGTCTAATACAATGACCGCCCTTT
GACGGCAGAAACATACTTGGCCGAGTCCTTGGATAAATTCAAGCACTCTT
TCAAGGACTTCACTGAGCACTTTGGGCGACCGCAGGTTCGGCAGCTCCTG
AAGCGTGAACTAGATCAGAAGGTGCTTGATTTCTTAGCTTCGAGGTACTG
GAATAAACCCCTTAGCGAGGATAAATCTTGGAACAGGCTCGACGAACGAC
CTATATCTGAACTGCCCAACACCGATTCTGAGAACCTTTATTGGCAGAGA
CGATTGGACGCCTCTACATCTGCTTTGACCAAGTTGGGGGTTGGAAGGCT
TGCAACCAATGTCGTAGCCAACGCTCTTCAGCAACACATGGATCGCCTCA
TCTCTGAATCAACCTTTCGCGCACACCCCTTTGCCAAGCAGGCTATCCAG
GAAGCTACAAATGCAATTTTGAACGAAAGATTCTACTCGACGAGTGACCA
GGTCGAGAACTGCATCAAACCTTACAAATTCGAGATTGAGGTGAATGACC
GCGAATGGGCTCAAAGCCGGGAAAATTCGCAAAACTTATTAAAGGAGGAA
CTTAAGGCTTGTGAAGATTCTTTGAAAAATTTGAAGAGCAATATTGGGCC
CAAGAAACTTCTTCAAGTTATGTCTTTTGTCGACAAGCTCCGGCAAGGAG
AACATGCAGATATGAAGGAGGGAACAGAGGCATTCGGTTTTAGCCGACCC
CTGTTACAAAAAGGGAGGGAAGGCGTCTTCCTAAGGGACAGGGCAGAGAT
ACTTAAGATGCGCTTGGTTGCTCTCAAGAGCAAGCAGTGCGCAACGTCAG
CGAGCAAATACCATTGCCCTGAGATTTTCTTGGATGTAGTCGCAGAGAAA
CTTACGTCTACCGCGGTTCTGTTTTTGAATGTAGAGCTGCTCTCAGAGTT
TTATTATAACTTTCCGAGAGAACTCGATAACCGTCTTGGCCGACATCTCT
CAAAACAGCAGGTCGAATCGTTTGCTAAAGAGGACCCCAAAATCCGAAAA
CATATTGAGCTTCAACAGCGAAAGGAGCTTCTTGGGTTAGCCCTTGAAAA
GATGGAAAGTTTGATGGCCTTAGAGAAGAGTAAGAAAGCACCGGTAG

Sequences in the Contig:

SY0AAA21YB11FM1 SY0AAA30YG04FM1 SY0AAB20YM12FM1
SY0AAC28YG10FM1 SY0AAC28YG10RM1 SY0AAD39YD21FM1
SY0AAD63YG19FM1