Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4237
Length(NT) : 1339
Best Gene Model Blast : Link to GSTUMT00002891001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213841.1| Score: 1663 E_value: 0.0
KEGG Definition: spindle pole body component (Alp6), putative
Accession: afm:AFUA_3G11320 Score: 1656 E_value: 0.0
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG2000 Score: 928 E_value: 1e-100
PFAM Definition: Spc97_Spc98, Spc97 / Spc98 family. The spindle pole body (SPB) functions as the microtubule-organising centre in yeast. Members of this family are spindle pole body (SBP) components such as Spc97 and Spc98 that form a complex with gamma-tubulin..
Pfam Number: pfam04130 Score: 902 E_value: 9e-98
Swissprot: Q9USQ2|ALP6_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005829 = Cellular component: cytosol
GO:0000923 = Cellular component: equatorial microtubule organizing center
GO:0000930 = Cellular component: gamma-tubulin complex
GO:0005634 = Cellular component: nucleus
GO:0005816 = Cellular component: spindle pole body
GO:0031122 = Biological process: cytoplasmic microtubule organization and biogenesis
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0000216 = Biological process: M/G1 transition of mitotic cell cycle
GO:0007020 = Biological process: microtubule nucleation
GO:0007094 = Biological process: mitotic cell cycle spindle assembly checkpoint
GO:0007091 = Biological process: mitotic metaphase/anaphase transition
GO:0030473 = Biological process: nuclear migration, microtubule-mediated
GO:0051225 = Biological process: spindle assembly

Sequence:
>Contig4237
TTGGACCTTCGCTTCTTTATAGATGTCTCAACGAGTTTGTGCAGTCGTCA
TCTGAAAGCGGCACTGACGGCGGATTAGTAGGCCAATCGCTCAAGTCTGC
AATTGGAATTGAGCTTCGGGGCTACATTAATCTCGTCGGCTGTTTGGAGA
ATGAAATCAGGAGAGCAGTTGCGGCTGCCGAGACTACTATCGGTGTAAGG
ACTGCGGGGGTTACGTTGAAGAGATGTGTTGTGTGGACTAGGGAGGCAAC
TATGGGCCTACGGCTGATGAGTTTGATAGTGGAGCAAACTAGTGATAAAA
AGGGGGGGCAACTCATTTCGACGATTCGTAGCTTTGCGTCATCGCATGGG
GACCCATTCGTACATGCGTTCGCAGAGCGACTGTTGAGCCATGTTACACG
ACCCTTTTATGATATGCTTCGACACTGGATCTATGATGGAGAGCTTACAG
ATCCTTATTTGGAGTTTTTCGTTATTGAGCAGCCCAATCTTCCAGATGGA
GGTGGCAACAAGGGGGGTGCTTCCTCAGTGTGGGAGGACAAATACACCAT
CCACTCGCCTCAAGTGCCTACTATTATGACGGAGTCGTTTGCGAAAAAAG
TATTCTTAATCGGCAAGTCCCTTAACTTCATCCGACATGGTTGCAGTGAT
TCGGAGTGGGTAGAGAGCTATTCAAAGTCAACATCTAAGGAATTGGGATA
TGGGGATACTGCGAGATTAGAAATGAGCATCGACGAAGCATATAAGACAA
CGATGGCTAGGCTTATTGAATTAATGGGGGGCAAATTTAAGCTATTTGAT
CACCTTCGAGCACTCAAGAAATATCTCCTTCTCGGCCAGGGTGATTTTAT
TGCGCTGCTTATGGAGGGGTTGTCCGCTAGCCTGGAAAGGCCGGCGAATA
CCTTATATCGCCATAACCTAACAGCCCAGCTAGAACATGCGATCCGTGGG
TCAAATGCACAGTTCGACTCTCCTGATGTCTTGAGAAGGCTTGACGCGAG
GATGTTGGAATTAAGCCACGGAGAGATTGGATGGGATGTGTTTACATTGG
AGTACAAGATCGACGCACCTGTGGATGTTGTCGTTACGCCTTACGGAAGT
AGGCAATATTTGAAGGTTTTTAACTTTTTATGGAGAGTAAAAAGAGTCGA
GTTTGCCCTTGGAAGTAGCTGGAGGCGATTTATGGCCGGAGCACGTGGGG
TATTGAAGGCTGTTGAAGATTTGGTGGGAGCCGACTGGAAAAAGGCTCGC
TGTGTTGTTGCAGAGATGGTTCACTTTGTTAACCAACTGCAATACTATAT
CCTATTCGAGGTTATCGAGTCCTCTTGGGATACTCTCCA

Sequences in the Contig:

SY0AAA22YB05FM1 SY0AAC28YG02FM1 SY0AAD39YP16FM1
SY0AAD9YM22FM1