Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4236
Length(NT) : 635
Best Gene Model Blast : Link to GSTUMT00003409001 E-value : 1e-118
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4236
TTGGACGGCCGCGACGTGTGCGTGCGGAAAAAGTGCGAGCGGCACGCTAA
CTGGCGATCTATTTTCGCGGATGAATCCCAGTTACAGGGCCGTCTTGTCA
GCGAGCGCCTCGTCCAGCTCAAGCACGAAGAGCGCAAGATTAAGGACCGA
CAGAAGAAGAGGAGTATCCGGGATTCCAGGGAGGGCGTGGTGGAGACCGG
GCCTTGGTTATGTTGAGTCGAGTTGGTTCTTGTCGTTCCTCTGCCGGATT
TCTTGTCTGTGACATTAAGGGTTCAATTGTGCGTACAAACAAAAGTGGAT
TTTATTCTTGTTTTTGTTCCTTCCTCCACAAGTATCATATGCGGTATTAC
CTTGCCTCACCGTTCTCTCCTTGTCACTTATTTGCCCTTTTATTATTATT
TTTATCCTCGTCTTCCTTTCTCCTCCTTTTGTCTATGCGTCTTCGTTCAC
AAAGTCCGGTATCGATTCCATCTCACGATGTGCATGACATGTCATGACCT
GTTATGGCTTATTTCTTTTACTATCATCGATACTTTGGTATCTTGGGTCT
GGGTAACGCTGTTAGTTTGTTCGCCTTATCACTTGTAGGTTAATTTACTT
GCGGTCGTGAATGGAGCGTGCTTGTTTTATCGTTG

Sequences in the Contig:

SY0AAC28YF19FM1 SY0AAC28YF19RM1 SY0AAD34YA22FM1