Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4235
Length(NT) : 676
Best Gene Model Blast : Link to GSTUMT00010595001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein CHGG_05685
Accession: ref|XP_001221780.1| Score: 152 E_value: 1e-08
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06476 Score: 148 E_value: 2e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4235
TTGGCTCCCGCCGAGCCCCGCCTCCCCGCGTTCTATTTCCATGACTTCCC
CACCGTGACGCCTTAACCAGCATGACTTCTGTTCGAGTTCCCTCCCCATC
TAGTTCTCCCTCCCCATCTCTGCGGTCTTCTTCTCCAGATAGGCCTGGGC
TGAGGGGAGCTCGCTCCTTTTCTCGCTTAGAGCCATCAACCTCGAACCCC
CTTTCGAAGTTACAGACGGAGCTCACAATCCCGGAGGTTCCGGATTCACC
CCCCGCTGCTTCGTCCGTTTCTAGGCTCGAGGAAAGCGAGGATGACGAAG
GCCCCCCGCTACCTTTGCCGGATGGGTTCGATGATCTCCCTATTGAGCTT
CTCAGTTTGACAGATCGTTTTATAGACTCCTTAGCAATGAAAATCCACCC
GACGCCCCTGGCAGTTGCACAGCTTATGGAGGTCTTCCAGCAGTTTTACC
TCACGGCTTTTCAACATGTCGATACTCACGTTTCACATTCTTACCTATCT
TTGGCGTCTAAGAAACCGCGGGCGTCCCCGGCAGCATCCAAGAACCCGAC
CCAGATGCTCTCTATCAGCGAGATTTCTCAGAAGAAAAAGGATCGGAGGC
TTTTAGAAGCCAAGCGATTGGCTCTCGAAGAAGCGGTGGAGAGAAGGATT
ACCGAGGGCCTTTACGATCGCATCTG

Sequences in the Contig:

SY0AAB34YJ09FM1 SY0AAC25YB20FM1 SY0AAC28YF13FM1
SY0AAC38YJ01FM1 SY0AAD27YG23FM1