Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4234
Length(NT) : 742
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4234
TTGGAACGTTGTTGCCTGGGGCGCAGGTGCTGCACCACCCAACATACTAT
AAGAAGCCCTTGCTTGCTTCGCTCTTCAAGATCAAGTGAGTGCCTTGTGC
GTGTTATGTTGCCTTTTCGTTCTTTGGTGTTATTGTTGAGCCTCATGTCG
ATTTGACTTGGCTCGGTCTGGGGAACGCGAACTGTCAACTGTGGAAAGGG
AGCGAACGGATGGGGCTGAACTTGGGTGATCGATTGAAGGTGAGATTTTA
ATTTTTCTTCTTTTCTTTTTTCTTCTTCTTTCAATATTGCGTCTCGTTGC
ATTTGGGTGTGTGCTTTTATGATTTTTTATTTTTATTTTTATCTTTTCGT
TTTCGGGCGTTTTCGACGTGATGTGCCGCTGTACGTGCGGTGAGGGAGGA
AAGTGATGGGGCTTTGCCTCGTCGCATTGTTGGAGAAGAGAGAGAGTTTA
GAAAAGGGAGGAAGAGAGAGAGAGGAAGGAAAGGAAGGGAAGGAAGAAGG
AGGGAAGGAAGGAAAGAAGGAAGGAAGAGGGATGTTTCCGAGGAAGGATT
GGCGGCATCATCATCATCATCATCATCATAGATGTTACCATACGGTGGGG
TTACCCCTTCCTGGTTATCTTATTAAGTTAATATGGTTTTTATACCTATG
ATACCTCATATCCAACCCCCCTTCCCTCCCCTCCCCTGAACTTTTTCTGC
TCACTCCTTCCCCCCACTGCCCCACTGCACACACACACATAC

Sequences in the Contig:

SY0AAB51YN21FM1 SY0AAC21YG22FM1 SY0AAC22YG22FM1
SY0AAC28YF12FM1